Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Kursteil D: DNA-Sequenzierung Bestimmung der Nukleotidsequenz der cDNA VfNDS-A Molekularbiologische Arbeitstechniken WS 2004/05 von Jennifer Wetzel.

Ähnliche Präsentationen


Präsentation zum Thema: "Kursteil D: DNA-Sequenzierung Bestimmung der Nukleotidsequenz der cDNA VfNDS-A Molekularbiologische Arbeitstechniken WS 2004/05 von Jennifer Wetzel."—  Präsentation transkript:

1 Kursteil D: DNA-Sequenzierung Bestimmung der Nukleotidsequenz der cDNA VfNDS-A Molekularbiologische Arbeitstechniken WS 2004/05 von Jennifer Wetzel

2 Gliederung D1: Extraktion der Plasmid-DNA Animpfen der Bakterienkulturen DNA-Gewinnung D2: Agarose-Gelelektrophorese D3: Sequenzierung der Plasmid-DNA Cycle-Sequencing Reaktionsaufreinigung Kapillarelektrophorese D4: DNA-Sequenzauswertung Vorprozessierung (Basecalling, Vector-clipping) Assembly

3 D1: Extraktion von Plasmid-DNA Animpfen der Bakterienkulturen (unterschiedliche E. coli -Stämme, die alle das selbe Insert tragen > cDNA VfNDS-A) GruppeStamm 1Stamm 2Stamm 3Stamm i176-2i i i i i i176-6a176-6b i176-2i i i

4 Lysat mittels Puffer3 (sauer) neutralisieren und abzentrifugieren Plasmid-DNA renaturiert und gelöst, chromosomale DNA und Proteine pelletiert Zellen durch Zugabe von Puffer2 (alkalisch) lysieren Denaturierung der chromosomalen und Plasmid-DNA Angezogene Zellen abzentrifugieren und in Puffer1 (RNAse-haltig) resuspendieren RNA wird hydrolisiert D1: Extraktion von Plasmid-DNA DNA-Gewinnung

5 Säule mit Elutionspuffer EB (1,4 M NaCl) eluieren Plasmid-DNA wird aus der Säule in Eppi gewonnen Säule mit PE-Puffer (1,2 M NaCl) waschen und zentrifugieren alle Moleküle < Plasmid-DNA werden ausgewaschen Überstand auf QIAprep Spinsäule (Kationenaustauscher) geben und zentrifugieren gelöste Zellbestandteile ordnen sich ihrer Größe entsprechend an D1: Extraktion von Plasmid-DNA

6 D2: Agarose-Gelelektrophorese Überprüfung der Reinheit und Konzentration der gewonnenen Plasmid-DNA Taschenbelegung: - 2 µl Aliquots der extrahierten Plasmide (mit Bromphenolblau angefärbt) - 5 µl DNA-Ladepuffer pro Gel zwei Konzentrationsstandarts bekannter Plasmid-DNA (=Marker)

7 D2: Agarose-Gelelektrophorese M1= 50ng-MarkerM2= 100ng-MarkerM3= 200ng-Marker St = E. coli-Stämme 1 bis 4 siehe Tabelle

8 D3: Sequenzierung der DNA Cycle-Sequencing In PCR-Streifen werden pro Gruppe 8 Ansätze pipettiert ng Plasmid-DNA - 3 µl Reaktionsmix (Polymerase, dNTPs, Terminatoren) - 1 µl Primer (pro Stamm je einmal M13 universal und M13 reverse) - 1 µl Betain - add 10 µl H 2 O Temperatur-Profil - 60 sec 96°C - 10 sec 96°C - 60 sec 60°C - Lagerung bei 4 -10°C x 30

9 Reaktionsaufreinigung D3: Sequenzierung der DNA Entfernen von nicht eingebauten Terminatoren, die DNA-Sequenzierung stören Gelfiltration mit Sephadex-G50 - Sephadex auf Mikrotiterplatte mit Wasser quellen - Sequenzierreaktionsprodukte werden aufgetragen und können bei Zentrifugation mit einer zweiten Mikrotiterplatte aufgefangen werden.

10 Kapillarelektrophorese D3: Sequenzierung der DNA Laseroptik am Ende der Kapillare detektiert die floureszierenden Terminatoren Injektion der DNA-Fragmente in die Kapillare - 9 V für 45 sec - DNA wandert ein Elektrophorese V für 200 min (3,3 h) - DNA-Fragmente werden ihrer Molekulargröße entsprechend aufgetrennt

11 D4: DNA-Sequenzauswertung primäres Basecalling (Herausrechnen der Effekte der Farbstoffe; Qualität der Sequenzierung) Vorprozessierung ScoreCard (Basensequenzlänge/Qualität [%])

12 D4: DNA-Sequenzauswertung sekundäres Basecalling (erneute Datenprozessierung, aber mit anderem Programm >objektiver) Darstellung der Basensequenz mit dem trev.editor (blaue Balken = Qualitätsangabe)

13 Vector-clipping mit VecScreen D4: DNA-Sequenzauswertung Vergleich der gewonnenen Datensequenz mit Vektor- Datenbanken in VecScreen Probleme: - (teilweise) schlechte Sequenz-Qualität - verwendeter Vektor existiert nicht in Datenbank

14 D4: DNA-Sequenzauswertung manuelles Vector-clipping - Suche nach Enzym-Schnittstellen GAATTC und CACCTC - Vergleich mit Angaben aus VecScreen - Markierung des Vektors Markierung des Vektorbereichs (rosa)

15 D4: DNA-Sequenzauswertung Template Display der überlappenden Stränge Contig 1Contig 2 Assembly mit GAP4 nur Basen mit Qualität > 20

16 D4: DNA-Sequenzauswertung Template Display der einzelnen Basen des Contigs Parameter: - Grauabstufung: Qualität der Sequenzierung dieser Base (je heller, desto besser) - grüne Markierungen: abweichende und fehlende Basen oder Basen mit Qualität < 20

17 D4: DNA-Sequenzauswertung Ergebnis: Nukleotidsequenz der cDNA VfNDS-A Contig 1: cggcacgaggccaatttatctcatcctcctttcacattgtcaaaatgtctaaacctgtctttcgagaatatattggtgtgaag ccagactcaaaaagtttggctgattttccacaaatcacccaaacagaaaccat Contig 2: aattcggcacgagcactgatataaattccataagaaaaagaaaacaagaacttattatattgatactaagagaagtaa ttctccacacttttaacataatacaaaaacacatgaaaaatacaatgggtcttatttaatatttaaaggctaatgcatatag agcttatagtctttgatagatgacccatatcacgaaagatttattactgactagatatagccagttagtcatcatttggcgag gagctcttccaagacatgctctactttgaaaggttcatccccattattggagtcattagcgttccagaaaaaaacaccgg gtagtgatgaggtttgtttgagttttgtgcagccaccaatgaatatatcccgtgtaattttaatatttatgtggtcaagcgggtc ggtgctaaatcctggaaggactttacgaggatggtagtcatttactaccctttcatagatgtctacaaaagcatcatctgtg gatacaggatttagttgattgctgaactgataatcaaccaaattgatatagtctgggtttgcattatacaaattcaggtagg aggatgcgttgttttcagatggagcaatggacaccacatggatgtttaggtcacgttcttttttgagttctgttataagttggcc tatcaacctaggaaacgcctcatcccatttgatgtgctcataattaatgtcaatgccatcaatcaagttgccgctttcatttttg tatttttgaatgatcagtttgagtgactttacagcgttcgaaacccatacattttgctcagctggatcgaatggagtttcaacg ccacgacctccaatgcttattaccacctttacctctggatgttttgttttcaaaattctcactttatctggaccgaagaactcat ccttccaagattcctcgaaatttcccgaaccttttctgctttcgttatacttttcagtggcaaagcccaaaatgaagt


Herunterladen ppt "Kursteil D: DNA-Sequenzierung Bestimmung der Nukleotidsequenz der cDNA VfNDS-A Molekularbiologische Arbeitstechniken WS 2004/05 von Jennifer Wetzel."

Ähnliche Präsentationen


Google-Anzeigen