Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Maximal Methodisch - das Methodenseminar MAXIMAL METHODISCH im INTRAnet: tmikpoh.charite.de/methods.

Ähnliche Präsentationen


Präsentation zum Thema: "Maximal Methodisch - das Methodenseminar MAXIMAL METHODISCH im INTRAnet: tmikpoh.charite.de/methods."—  Präsentation transkript:

1 Maximal Methodisch - das Methodenseminar MAXIMAL METHODISCH im INTRAnet: tmikpoh.charite.de/methods

2 DNA-Sequenzierung MAXIMAL METHODISCH Das Methodenseminar Lena Wronski

3 Maximal Methodisch - das Methodenseminar Methoden Kettenabbruchmethode nach Sanger Maxam-Gilbert-Methode Sequenzierung durch Hybridisierung

4 Maximal Methodisch - das Methodenseminar Methoden Kettenabbruchmethode nach Sanger Maxam-Gilbert-Methode Sequenzierung durch Hybridisierung

5 Maximal Methodisch - das Methodenseminar Prinzip enzymatische Neusynthese von DNA Analyse der neusynthetisierten DNA

6 Maximal Methodisch - das Methodenseminar Prinzips des Kettenabruchs Bausteine der DNA-Neusynthese: dNTPs (N= A, C, G oder T) Sequenzreaktion: ddNTPS im Reaktionsmix bei Einbau keine Verlängerung durch PolymeraseKettenabbruch

7 Maximal Methodisch - das Methodenseminar ddNTPs Didesoxyribunukleosidiphopsphate

8 Maximal Methodisch - das Methodenseminar

9 Markierung des Abbruchpunktes Markierung des Primers Markierung der ddNTPs radioaktiv mit Fluoreszenzfarbstoffen (DyeTerminatoren)

10 Maximal Methodisch - das Methodenseminar Vorteile der DyeTerminatoren One-Tube Reaktionen keine Termination sites keine markierten Primer nötig Verhältnis dNTPs/ddNTPs bestimmt Sequenzlänge direkte Sequenzierung von PCR-Produkten möglich

11 Maximal Methodisch - das Methodenseminar AGCCTGAAGGACTTAGCGTAACA TCGGAC TCGGACT TCGGACTT TCGGACTTC TCGGACTTCC TCGGACTTCCT TCGGACTTCCTG TCGGACTTCCTGA TCGGACTTCCTGAA Polymerase + dNTPS + ddNTPS + Primer Sequenzreaktion

12 Maximal Methodisch - das Methodenseminar

13 Auftrennung der entstandenen Fragmente durch Gelelektrophorese Kleine DNA-Fragmente laufen schnell, größere bleiben zurück Vorteil der Laserdetektion: Endpunktdetektion größere Fragmente können noch unterschieden werden lesbare Sequenzlänge nimmt zu

14 Maximal Methodisch - das Methodenseminar

15

16

17 Ablauf DNA-Präparation (PCR) Aufreinigung des Produkts Sequenzreaktion Aufreinigung Sequenzierung Datenauswertung

18 Maximal Methodisch - das Methodenseminar DNA-Präparation Qualität WICHTIG –unbedingt Kit-Protokollen folgen Quantität WICHTIG –Photometer –Gelabschätzung

19 Maximal Methodisch - das Methodenseminar Aufreinigung von PCR-Produkten Abtrennung von überschüssigen Primern, dNTPs, Salzen Gelsäulen (z.b.QiaQuick PCR-Purification Kit) Verdau mit SAP und Exo1 Gelelution Fällung: 4M Ammoniumacetat Filtermembran (Centricon, Microcon)

20 Maximal Methodisch - das Methodenseminar Sequenzierprimer 22-24mer Bindungsstelle ca 50bp vor der eigentl.Sequenz Basenzusammensetzung ausgewogen G/C-Gehalt ~50% 3Ende: G oder C Tm >50°C evtl PCR-Primer übernehmen?

21 Maximal Methodisch - das Methodenseminar Möglichst vermeiden: Primer-Dimere Sekundäre Bindungsstellen Sekundärstrukturen Repeats

22 Maximal Methodisch - das Methodenseminar Template-Menge TemplateErforderliche Menge PCR-Produkt bp bp bp bp >2000bp 1-3ng 3-10ng 5-20ng 10-40ng ng Einzelstrang-DNA50-100ng Doppelstrang-DNA ng große DNA(BACs, PACs, Cosmide etc) 0,1-1,0ug Bakterien-DNA2-3ug

23 Maximal Methodisch - das Methodenseminar Reaktionsansatz Sequenzier-PCR ReagenzKonzentrationVolumen Reaktionsmix2,5x4ul Puffer5X2ul Primer-3,2pmol Template- s.Templatemenge Wasser-ad 20ul Endvolumen20ul

24 Maximal Methodisch - das Methodenseminar Aufreinigung nach Sequenzierreakton Spin Column/Plate Zeit zwischen Herstellung und Verwendung? Ladevolumen? Zentrifuge, Parameter? Fällung Temperatur? Zentrifugation? Mischen? Ethanolreste vermeiden!

25 Maximal Methodisch - das Methodenseminar Auswertung DNA-Star, Sequence Analysis Sequencher Freeware: CHROMAS (http://www.technelysium.com.au/chromas.html)http://www.technelysium.com.au/chromas.html AbiView (http://bioinformatics.weizmann.ac.il/software/abiview/abi view.html

26 Maximal Methodisch - das Methodenseminar Gute Daten

27 Maximal Methodisch - das Methodenseminar Basecalling Algorithmus zur Filterung der Rohdaten Achtung! Basecaller und DyeSet müssen zusammenpassen! Dyeset richtet sich nach Art des DyeTerminator Mix!

28 Maximal Methodisch - das Methodenseminar Chromatogramm

29 Maximal Methodisch - das Methodenseminar Annotations Anmerkungen des Analyseprogramms zu Signalstärke, Lauflänge Spacing (Abstand der einzelnen Signale)

30 Maximal Methodisch - das Methodenseminar Troubles die häufigsten Phänomene DNA Template-Menge zu viel zu wenig Template-Qualität Kontaminationen Inhibitoren Salze

31 Maximal Methodisch - das Methodenseminar Troubles die häufigsten Phänomene Primerqualität Restprimer Primer-Dimere Qualität (Alter? wie oft schon verwendet? Wie oft aufgetaut/eingefroren?)

32 Maximal Methodisch - das Methodenseminar Troubleshooting Parameter zur Problemerkennung Chromatogramm Signalbild Hintergrund (Rauschen Reichweite

33 Maximal Methodisch - das Methodenseminar Troubleshooting Parameter zur Problemerkennung Rohdaten Intensitäten unspezifische Signale Annotations relative Signalstärke Spacing

34 Maximal Methodisch - das Methodenseminar Zur Erinnerung – so sehen gute Rohdaten aus

35 Maximal Methodisch - das Methodenseminar Sequenzreaktion fehlgeschlagen

36 Maximal Methodisch - das Methodenseminar Zu viel Template

37 Maximal Methodisch - das Methodenseminar Zu viel Template

38 Maximal Methodisch - das Methodenseminar Zu wenig Template

39 Maximal Methodisch - das Methodenseminar Gemischte Sequenzen -mehrere Templates im Ansatz -mehrfache Primerbindungsstellen

40 Maximal Methodisch - das Methodenseminar Kontamination durch mangelhafte Aufreinigung

41 Maximal Methodisch - das Methodenseminar Mangelnde Aufreinigung

42 Maximal Methodisch - das Methodenseminar Rascher Signalverlust GC-/GT-reiche Regionen, Sekundärstrukturen vorhanden

43 Maximal Methodisch - das Methodenseminar Dye Blobs zu wenig Template/Kontaminationen, die Dye-Klumpen bilden

44 Maximal Methodisch - das Methodenseminar Slippage/Abrutschen Sequenz enthält Repeats, Polymerase rutscht aus

45 Maximal Methodisch - das Methodenseminar


Herunterladen ppt "Maximal Methodisch - das Methodenseminar MAXIMAL METHODISCH im INTRAnet: tmikpoh.charite.de/methods."

Ähnliche Präsentationen


Google-Anzeigen