Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

tmikpoh.charite.de/methods

Ähnliche Präsentationen


Präsentation zum Thema: "tmikpoh.charite.de/methods"—  Präsentation transkript:

1 tmikpoh.charite.de/methods
MAXIMAL METHODISCH im INTRAnet: tmikpoh.charite.de/methods Maximal Methodisch - das Methodenseminar

2 MAXIMAL METHODISCH Das Methodenseminar 25.07.2005 Lena Wronski
DNA-Sequenzierung MAXIMAL METHODISCH Das Methodenseminar Lena Wronski

3 Maximal Methodisch - das Methodenseminar
Kettenabbruchmethode nach Sanger Maxam-Gilbert-Methode Sequenzierung durch Hybridisierung Maximal Methodisch - das Methodenseminar

4 Maximal Methodisch - das Methodenseminar
Kettenabbruchmethode nach Sanger Maxam-Gilbert-Methode Sequenzierung durch Hybridisierung Maximal Methodisch - das Methodenseminar

5 Maximal Methodisch - das Methodenseminar
Prinzip enzymatische Neusynthese von DNA Analyse der neusynthetisierten DNA Maximal Methodisch - das Methodenseminar

6 Prinzips des Kettenabruchs
Bausteine der DNA-Neusynthese: dNTPs (N= A, C, G oder T) Sequenzreaktion: ddNTPS im Reaktionsmix bei Einbau keine Verlängerung durch Polymerase Kettenabbruch Maximal Methodisch - das Methodenseminar

7 Maximal Methodisch - das Methodenseminar
ddNTPs Didesoxyribunukleosidiphopsphate Maximal Methodisch - das Methodenseminar

8 Maximal Methodisch - das Methodenseminar

9 Markierung des Abbruchpunktes
Markierung des Primers Markierung der ddNTPs radioaktiv mit Fluoreszenzfarbstoffen (DyeTerminatoren) Maximal Methodisch - das Methodenseminar

10 Vorteile der DyeTerminatoren
One-Tube Reaktionen keine Termination sites keine markierten Primer nötig Verhältnis dNTPs/ddNTPs bestimmt Sequenzlänge direkte Sequenzierung von PCR-Produkten möglich Maximal Methodisch - das Methodenseminar

11 Maximal Methodisch - das Methodenseminar
Sequenzreaktion AGCCTGAAGGACTTAGCGTAACA TCGGAC TCGGACT TCGGACTT TCGGACTTC TCGGACTTCC TCGGACTTCCT TCGGACTTCCTG TCGGACTTCCTGA TCGGACTTCCTGAA Polymerase + dNTPS + ddNTPS + Primer Maximal Methodisch - das Methodenseminar

12 Maximal Methodisch - das Methodenseminar

13 Maximal Methodisch - das Methodenseminar
Auftrennung der entstandenen Fragmente durch Gelelektrophorese Kleine DNA-Fragmente laufen schnell, größere bleiben zurück Vorteil der Laserdetektion: Endpunktdetektion größere Fragmente können noch unterschieden werden lesbare Sequenzlänge nimmt zu Maximal Methodisch - das Methodenseminar

14 Maximal Methodisch - das Methodenseminar
Hier noch Abi-Maschine einfügen!!! Maximal Methodisch - das Methodenseminar

15 Maximal Methodisch - das Methodenseminar

16 Maximal Methodisch - das Methodenseminar

17 Maximal Methodisch - das Methodenseminar
Ablauf DNA-Präparation (PCR) Aufreinigung des Produkts Sequenzreaktion Aufreinigung Sequenzierung Datenauswertung Maximal Methodisch - das Methodenseminar

18 Maximal Methodisch - das Methodenseminar
DNA-Präparation Qualität WICHTIG unbedingt Kit-Protokollen folgen Quantität WICHTIG Photometer Gelabschätzung Maximal Methodisch - das Methodenseminar

19 Aufreinigung von PCR-Produkten
Abtrennung von überschüssigen Primern, dNTPs, Salzen Gelsäulen (z.b.QiaQuick PCR-Purification Kit) Verdau mit SAP und Exo1 Gelelution Fällung: 4M Ammoniumacetat Filtermembran (Centricon, Microcon) Maximal Methodisch - das Methodenseminar

20 Maximal Methodisch - das Methodenseminar
Sequenzierprimer 22-24mer Bindungsstelle ca 50bp vor der eigentl.Sequenz Basenzusammensetzung ausgewogen G/C-Gehalt ~50% 3‘Ende: G oder C Tm >50°C evtl PCR-Primer übernehmen? Maximal Methodisch - das Methodenseminar

21 Maximal Methodisch - das Methodenseminar
Möglichst vermeiden: Primer-Dimere Sekundäre Bindungsstellen Sekundärstrukturen Repeats Maximal Methodisch - das Methodenseminar

22 Maximal Methodisch - das Methodenseminar
Template-Menge Template Erforderliche Menge PCR-Produkt bp bp bp bp >2000bp 1-3ng 3-10ng 5-20ng 10-40ng 40-100ng Einzelstrang-DNA 50-100ng Doppelstrang-DNA ng große DNA(BACs, PACs, Cosmide etc) 0,1-1,0ug Bakterien-DNA 2-3ug Maximal Methodisch - das Methodenseminar

23 Reaktionsansatz Sequenzier-PCR
Reagenz Konzentration Volumen Reaktionsmix 2,5x 4ul Puffer 5X 2ul Primer - 3,2pmol Template s.Templatemenge Wasser ad 20ul Endvolumen 20ul Maximal Methodisch - das Methodenseminar

24 Aufreinigung nach Sequenzierreakton
Spin Column/Plate Zeit zwischen Herstellung und Verwendung? Ladevolumen? Zentrifuge, Parameter? Fällung Temperatur? Zentrifugation? Mischen? Ethanolreste vermeiden! Maximal Methodisch - das Methodenseminar

25 Maximal Methodisch - das Methodenseminar
Auswertung DNA-Star, Sequence Analysis Sequencher Freeware: CHROMAS (http://www.technelysium.com.au/chromas.html) AbiView (http://bioinformatics.weizmann.ac.il/software/abiview/abiview.html Maximal Methodisch - das Methodenseminar

26 Maximal Methodisch - das Methodenseminar
Gute Daten Maximal Methodisch - das Methodenseminar

27 Maximal Methodisch - das Methodenseminar
Basecalling Algorithmus zur „Filterung der Rohdaten“ Achtung! Basecaller und DyeSet müssen zusammenpassen! Dyeset richtet sich nach Art des DyeTerminator Mix! Maximal Methodisch - das Methodenseminar

28 Maximal Methodisch - das Methodenseminar
Chromatogramm Maximal Methodisch - das Methodenseminar

29 Maximal Methodisch - das Methodenseminar
Annotations Anmerkungen des Analyseprogramms zu Signalstärke, Lauflänge Spacing (Abstand der einzelnen Signale) Maximal Methodisch - das Methodenseminar

30 Troubles die häufigsten Phänomene
DNA Template-Menge zu viel zu wenig Template-Qualität Kontaminationen Inhibitoren Salze Maximal Methodisch - das Methodenseminar

31 Troubles die häufigsten Phänomene
Primerqualität Restprimer Primer-Dimere Qualität (Alter? wie oft schon verwendet? Wie oft aufgetaut/eingefroren?) Maximal Methodisch - das Methodenseminar

32 Troubleshooting Parameter zur Problemerkennung
Chromatogramm Signalbild Hintergrund (Rauschen Reichweite Maximal Methodisch - das Methodenseminar

33 Troubleshooting Parameter zur Problemerkennung
Rohdaten Intensitäten unspezifische Signale Annotations relative Signalstärke Spacing Maximal Methodisch - das Methodenseminar

34 Zur Erinnerung – so sehen gute Rohdaten aus
Maximal Methodisch - das Methodenseminar

35 Sequenzreaktion fehlgeschlagen
Maximal Methodisch - das Methodenseminar

36 Maximal Methodisch - das Methodenseminar
Zu viel Template Maximal Methodisch - das Methodenseminar

37 Maximal Methodisch - das Methodenseminar
Zu viel Template Maximal Methodisch - das Methodenseminar

38 Maximal Methodisch - das Methodenseminar
Zu wenig Template Maximal Methodisch - das Methodenseminar

39 Maximal Methodisch - das Methodenseminar
Gemischte Sequenzen -mehrere Templates im Ansatz -mehrfache Primerbindungsstellen Maximal Methodisch - das Methodenseminar

40 Kontamination durch mangelhafte Aufreinigung
Maximal Methodisch - das Methodenseminar

41 Mangelnde Aufreinigung
Maximal Methodisch - das Methodenseminar

42 Rascher Signalverlust
GC-/GT-reiche Regionen, Sekundärstrukturen vorhanden Maximal Methodisch - das Methodenseminar

43 Maximal Methodisch - das Methodenseminar
Dye Blobs zu wenig Template/Kontaminationen, die Dye-Klumpen bilden Maximal Methodisch - das Methodenseminar

44 Slippage/“Abrutschen“
Sequenz enthält Repeats, Polymerase „rutscht aus“ Maximal Methodisch - das Methodenseminar

45 Maximal Methodisch - das Methodenseminar


Herunterladen ppt "tmikpoh.charite.de/methods"

Ähnliche Präsentationen


Google-Anzeigen