Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Einführung in die schulmedizinische Tumortherapie.

Ähnliche Präsentationen

Präsentation zum Thema: "Einführung in die schulmedizinische Tumortherapie."—  Präsentation transkript:

1 Einführung in die schulmedizinische Tumortherapie

2 der menschliche Körper besteht aus 100 Billionen Zellen eine 1 mit 14 Nullen beim einem erwachsenem Menschen werden in jeder Sekunde etwa 50 Millionen Zellen abgebaut und es bilden sich fast ebenso viele Zellen neu aber eben nur fast! der erwachsene Mensch baut nach und nach ab!

3 der menschliche Körper besteht aus 100 Billionen Zellen unser Gehirn besitzt 20 Milliarden Nervenzellen täglich verlieren wir 100.000 Nervenzellen, dies entspricht ungefähr der Größe eines Fliegenhirns

4 der menschliche Körper besteht aus 100 Billionen Zellen die Zellen unserer Lippen werden 2 Wochen alt die Leberzellen 8 Monate die Knochenzellen bis 30 Jahre alt

5 Alle Zellen entstehen durch Zellteilung pro Menschenleben sind das 10 16 Zellteilungen eine 1 mit 16 Nullen ( ) eine Zellteilung dauert ungefähr 24 Stunden bei jeder Zellteilung wird die Erbinformation identisch an beide Tochterzellen weitergegeben

6 Alle Zellen entstehen durch Zellteilung alle Zellen eines Organismus gehen auf eine befruchtete Eizelle zurück, also enthalten alle Zellen die gleiche genetische Information

7 jeder Mensch besitzt etwa 28.000 Gene Gene machen uns zu dem was wir sind Gene bestimmen mit, welche Augen- oder Haarfarbe wir besitzen ob wir ein großes oder geringes Risiko haben, an Krankheiten, wie z.B. Krebs zu erkranken jedes Gen steuert eine definierte Funktion einer Zelle bzw. eines Gewebes

8 jeder Mensch besitzt etwa 28.000 Gene die Gene liegen gut geschützt im Zellkern auf den Chromosomen jedes Chromosom besteht aus einzelnen DNA Fäden DNA ist die chemische Substanz der Gene besteht aus einer Strickleiter, der Doppelhelix

9 jeder Mensch besitzt etwa 28.000 Gene die Sprossen der Strickleiter bestehen aus den Kernbasen: Adenin Cytosin Thymin Guanin das Alphabet der Gene

10 jeder Mensch besitzt etwa 28.000 Gene das Gen-Alphabet übersetzt die genetische Information in eine Anleitung für den Bau von Proteinen das Hämoglobin- Gen zum Beispiel beginnt mit CCCTGTGGAGCCACACCCTAG ………. und ist insgesamt 43.000 Bausteine lang


12 jeder Mensch besitzt etwa 28.000 Gene seit dem Jahre 2003 wissen die Genforscher, das 3,2 Milliarden solcher Bausteine auf dem DNA-Faden des Menschen Platz haben nicht alle Abschnitte der DNA enthalten Informationen in einem recht großen Anteil scheinen tatsächlich keinerlei Informationen zu sein Junk - DNA, also Abfall - DNA

13 Vom Gen zum Protein Grundbaustein der Proteine ist ein Satz von 20 Aminosäuren Proteine machen erst das Wesen der Zelle aus als Enzyme Hormone Immunoglobuline

14 Vom Gen zum Protein sie transportieren im Körper bestimmte chemische Verbindungen z.B. Eisen (Transferrin) der komplette Energiehaushalt wird von Proteinen organisiert Zellen bestehen neben Wasser zum größten Teil aus Proteinen

15 Vom Gen zum Protein Der Schritt vom Gen zum Protein ist aufgeteilt in Transkription: geschieht im Zellkern, das Enzym RNA- Polymerase kopiert die DNA Information in RNA es entsteht die so genannte mRNA Thymin wird durch Uracil ersetzt

16 Vom Gen zum Protein das Überschreiben von DNA auf RNA ist vergleichbar mit einer Sicherheitsmaßnahme der Natur: die Orginalversion verlässt den schützenden Zellkern nicht zum Protein übersetzt wird lediglich eine Kopie dies geschieht außerhalb des Zellkerns in den Ribosomen

17 Vom Gen zum Protein dieser zweite Schritt bei der Entstehung eines Proteins heißt : Translation jeweils drei Bausteine auf dem mRNA Faden werden in bestimmte Aminosäuren umgewandelt aus CUU wird z. B. Leucin aus AGA wird Arginin die einzelnen Aminosäuren reihen sich aneinander und aus der entstehenden Kette faltet sich das dreidimensionale Protein

18 Vom Gen zum Protein

19 Der Zellzyklus den Zellzyklus kann man in zwei Phasen einteilen Mitose, gleich Zellkernteilung, und der Interphase: Zeitraum zwischen den Kernteilungen, sie ist die längste Phase des Zellzyklus kann bei teilungsaktiven Zellen bis zu 90 % des gesamte Zellzyklus ausmachen

20 Der Zellzyklus

21 Zellen, die sich im Zellzyklus befinden bei denen sich Zellwachstum und Zellteilung fortwährend abwechseln werden als proliferierend bezeichnet die Anzahl der Zellteilungen pro Zeiteinheit ist die Teilungsrate diese ist für jeden Zelltyp spezifisch

22 Regulation des Zellzyklus äußere Faktoren sind unter anderem das Nährstoffangebot die Anzahl der Nachbarzellen Wachstumsfaktoren: Proteine, die als Signal von einer Zelle auf die nächste übertragen werden Z. B. Fibroblast growth factor ( FGF ) Schlüsselrolle bei der Differenzierung der Zellen

23 Regulation des Zellzyklus innere Faktoren und Kontrollpunkte: so genannte Tumorsuppressorgene überwachen die korrekte Abfolge der Basenpaare nach jeder Reduplikation entscheiden über die Notwendigkeit von Reparaturvorgängen, halten den Zellzyklus an, bis Reparaturen ausgeführt sind, und veranlassen gegebenenfalls den programmierten Zelltod = Apoptose

24 Die Apoptose die Apoptose, also der Selbstmord einzelner Zellen, kann auch von außen angeregt werden, z. B. von Immunzellen während der Apoptose schrumpft die Zelle, die DNA wird von bestimmten Enzymen, den Endonukleasen abgebaut, die Apoptose gewährleistet, das die betreffende Zelle ohne Schädigung von Nachbarzellen zugrunde geht

25 Die Apoptose Apoptose ist unerlässlich: zur Kontrolle der Zellzahl und der Größe von Geweben bei der Verjüngung von Geweben z. B. Riechepthel der Nase bei Selektion und Abbau unnötiger Zellen des Immunsystems zur Eliminierung entarteter Zellen zur Selektion von Keimzellen, 95% der Eizellen werden über Apoptose abgetötet

26 Die Apoptose ein Ziel der Krebsforschung ist es, kontrollierte Apoptose bei Tumorzellen auszulösen dummerweise nutzen auch Krebszellen den Apoptosemechanismus um Abwehrzellen, so genannte Tumorinfiltrierende Lymphozyten auszuschalten an der Oberfläche verschiedener Tumorzelllinien ein Apoptose- auslösendes Protein, den CD95- Liganden (Fas Ligand ) diesen Mechanismus bezeichnet man als Tumor counterattack

27 Wie entsteht Krebs

28 die Zellteilung, und deren korrekter Ablauf wird von über 5000 Genen überwacht, diese Gene nennt man treffenderweise auch Wächtergene = Tumorsuppressorgene, z. B. p53, p16, p27 eine Krebszelle entsteht, wenn in mindestens einem der Wächtergene ein Defekt vorliegt

29 Wie entsteht Krebs dieser kann spontan auftreten, durch äußere Einflüsse wie z. B. Strahlung oder wird in vielen Fällen auch von den Eltern geerbt

30 Wie entsteht Krebs da es unglaublich viele Wächtergene gibt, die alle verschiedene Aufgaben haben, also für unterschiedliche Bereiche zuständig sind und weil die DNA ein sehr, sehr langes Band ist, führt der Defekt eines Wächtergenes nicht zwangsläufig vor allem auch nicht sofort zu krankhaften Veränderungen

31 Wie entsteht Krebs damit die mutierte Zelle nicht erkannt wird, muss der Aufgabenbereich des defekten Wächtergens und der Fehler, der bei der Kopie entsteht, exakt übereinander liegen ansonsten würde der Fehler von einem anderen Gen erkannt,und somit repariert, oder die Zelle würde eliminiert

32 Wie entsteht Krebs Aufgrund der millionenfachen Zellteilungen die täglich in unserem Körper stattfinden, wird der genetische Defekt mit fortschreitender Zeit immer wahrscheinlicher bis schließlich die eine fehlerhafte Zelle entsteht, die nicht repariert wird, und auch nicht dem programmierten Zelltod zugeführt wird,

33 Wie entsteht Krebs diese eine fehlerhafte Zelle mit der Fähigkeit sich zu teilen, wird mit hoher Wahrscheinlichkeit Tochterzellen produzieren, die noch mehr Mutationen aufweisen die Ent-artung der Zellen steigt mit jeder neuen Teilung, und immer gefährlichere Tumorzellen entstehen


35 Tumorstoffwechsel neben der Eigenschaft sich nun unkontrolliert zu vermehren,entstehen völlig andere Stoffwechsel- Eigenschaften : die Abgabe von immunsuppressiven Substanzen Expression des Pyruvatkinase-Isoenzyms Typ2 = Tumor M2-PK Hemmung der ß – Oxidation = Fettstoffwechsel

36 Tumorstoffwechsel hohe Aktivität der Glycolyse – Enzymen hohe Glutaminolyse - Kapazität anaerober Stoffwechsel unter Bildung von Laktat = Milchsäure die Vergärung von Glucose liefert wesentlich weniger Energie, daher nehmen Tumorzellen 20- bis 30-mal mehr Glucose auf

37 Tumorstoffwechsel dabei produzieren sie große Mengen Laktat, welches in der Leber unter erheblichem Energieaufwand erneut in Glucose umgebaut werden muss, um dann wieder von den Tumorzellen als Energielieferant benutzt zu werden

38 Tumorstoffwechsel erklärt auch den bei Tumorpatienten erhöhten Energiebedarf, die Kachexie = Auszehrung : anaerobe Glycolyse führt zu Hypoglycämie und Azidose, dies triggert die Ausschüttung von Adrenalin, Glucocorticoiden und Glucagon, daraus erfolgt Lipolyse und Proteinlyse aus Muskel- und Fettgewebe

39 Tumorstoffwechsel die Abhängigkeit der Tumorzellen von Sauerstoff nimmt drastisch ab das Abschalten der Mitochondrien führt zu Resistenzen gegenüber vielen Chemotherapeutika

40 Tumorformen in Abhängigkeit von seiner Fähigkeit Metastasen zu bilden,unterscheidet man benigne = gutartige maligne = bösartige und semimaligne Tumoren = Basalgiom maligne Tumoren werden außerdem in niedrig-maligne und hochmaligne eingeteilt,

41 Tumorformen benigne Tumoren = gutartige Gewebeveränderungen wachsen langsam, sind gut abgrenzbar, gut differenziert, bilden keine Metastasen die Benennung erfolgt durch die angehängte Endung -om an den lateinischen Namen des Ursprungsgewebes

42 Tumorformen Fibrom: Stielwarze, Fleischwarze Chondrom: gutartiger Tumor des Knorpels Adenom: gutartiger Tumor des Drüsengewebes Meningeom: gutartiger Tumor der Hirnhaut Adenomatoidtumor: gutartiger Tumor im Bereich der Genitalien Myom: gutartiger Tumor des Muskelgewebes, z. B. Uterusmyom

43 Tumorformen benigne Tumoren beeinträchtigen den Körper in der Regel nicht allerdings können einige benigne Tumoren zu malignen Zellen mutieren, z.B. Dickdarmpolypen die häufig zum Karzinom entarten Hormonproduzierende Adenome können durch ihre Hormonwirkung zu Erkrankungen führen Tumoren können durch ihre Raumforderungen maligne sein: z.B. das Meningeom

44 Tumorformen maligne Tumoren = bösartige Gewebeveränderungen wachsen schnell und invasiv, sind schlecht abgrenzbar, Zellen sind atypisch verändert bilden Metastasen auch bösartige Tumoren werden, soweit noch erkennbar nach dem Ursprungsgewebe benannt

45 Tumorformen Karzinome = das lateinische Wort für Krebs machen 80 % der Krebserkrankungen aus, und gehen vom Epithelgewebe aus: Plattenepithelkarzinome: Schleimhaut, verhornt und unverhornt Adenokarzimone: vom Drüsenepithel ausgehend Urothelkarzinome: entstehen in der Epithelschicht der ableitenden Harnwege Chorionkarzinome: entstehen aus pluripotenten Keimzellen

46 Tumorformen Sarkome= das griechische Wort für Fleisch leiten sich aus dem Binde- und Stützgewebe ab sind mit 1% aller malignen Erkrankungen selten

47 Tumorformen Osteosarkom: vom Knochen ausgehend Rhabdomysarkome: von der quergestreiften Muskulatur ausgehend Angiosarkome: von den Blutgefäßen ausgehend Leiomyosarkome: von der glatten Muskulatur ausgehend Liposarkom: vom Fettgewebe ausgehend Fibrosarkom: Form von Hautkrebs Neurogenes Sarkom: vom peripheren Nervensystem ausgehend

48 Tumorformen Blastome = Tumoren die aus embryonalen Zellen, während der Gewebe- oder Organentwicklung entstehen Retinoblastom: von embryonalen Netzhautzellen ausgehend Medulloblastom: von embryonalen Kleinhirnzellen ausgehend Nephroblastom: ( Wilms-Tumor ) von embryonalen Nierenzellen ausgehend Hepatoblastom: von embryonalen Leberzellen ausgehend

49 Tumorformen Hämatologische Tumoren= Tumoren die sich aus Blut- oder Blutstammzellen entwickeln: Leukämien: gehen von den Leukozyten aus Lymphome: gehen von den Lymphozyten aus

50 Krebsauslösende Faktoren grundsätzlich sind Zellen während der Zellteilung besonders anfällig Physikalische Noxen: Ionisierende Strahlung wie ultraviolettes Licht, Röntgen – oder Gammastrahlung, elektromagnetische Felder wie Mobilfunk, Mikrowelle

51 Krebsauslösende Faktoren Chemische Noxen: die wichtigsten sind polyzyklische Kohlenwasserstoffe: Benzol: früher als Lösungsmittel verwendet, zu 1% im Benzin enthalten, in USA verboten Benzpyren: in Zigarettenrauch, Teer- und Abgasen Chrom- VI – Verbindungen: Korrosionsschutzmittel in Kühlschränken Nitrosamine: geräucherte Fleisch- und Fischware


53 Krebsauslösende Faktoren Onkoviren: nach Schätzung der amerikanischen Krebsgesellschaft werden etwa 15-20 % der Krebsfälle durch Onkoviren verursacht wichtige Onkoviren sind: Papillomaviren ( HPV ) Retroviren ( HIV ) Hepadnaviren ( HBV ) Herpesviren

54 Krebsauslösende Faktoren Beispiel Papillomaviren: eine HPV Infektion mit den so genannten high risk Viren – Stämmen ist in 99,7 % die Ursache für ein Zervixkarzimon das Virus stimuliert die Zellproliferation verzögert die Differenzierung der infizierten Zelle, Genprodukte des Virus unterdrücken Reparaturen der DNA und letztlich die Apoptose

55 Krebsauslösende Faktoren es kommt zur genetischen Instabilität der befallenen Zervixzellen PAP III d = Dysplasie, Nachweis von Zellen mit leichten bis mittelschweren Zellveränderungen, wird in der Regel alle 3 Monate kontrolliert PAP IV = Konisation

56 Krebsauslösende Faktoren Onkogene Gene, die das Wachstum von Tumoren auslösen können, entstehen aus Proto-Onkogene, durch Veränderungen an Gensequenzen= Mutationen Auslöser: ionisierende Strahlung, chemische Substanzen und Onkoviren

57 Krebsauslösende Faktoren die Proliferation einer Zelle wird positiv von Protoonkogenen, und negativ durch Tumorsuppressoren wie p 53 oder p RB reguliert

58 Krebsauslösende Faktoren Embryonale Stammzellen können unter bestimmten Umständen Krebs auslösen Stamm – und Krebszellen sind bildlich gesprochen, die zwei Seiten einer Medaille die embryonale Stammzelle ist pluripotent, kann sich also in jede einzelne Zellart wandeln, zum Beispiel in eine Knochen, Muskel – oder Nervenzelle und kann sich im Prinzip unendlich oft teilen, ist unsterblich!

59 Krebsauslösende Faktoren ausgerechnet diese Eigenschaft hat sie mit der tödlichen Tumorzelle gemeinsam man weiß erst seit wenigen Jahren, das es neben den guten Stammzellen, auch höchst gefährliche Krebs-Stammzellen gibt Forscher vermuten sogar das Tumoren durch einige wenige Krebs-Stammzellen überhaupt erst tödlich werden

60 Statistik Statistisch gesehen entwickelt jeder dritte Europäer im Laufe seines Lebens Krebs! die meisten Fälle treten im Alter über 60 Jahren auf einer US-Studie zufolge sterben weltweit jeden Tag etwa 20.000 Menschen an den folgen einer Krebserkrankung demnach gab es in Deutschland erkranken jährlich rund 400.000 Menschen an Krebs 2008 7,6 Millionen Tote durch Krebs


62 Statistik übrigens ist Krebs keinesfalls eine Erkrankung der Neuzeit die ältesten Krebsbefunde liefern Saurierknochen in Papyrusschriften sind Krebserkrankungen aus der Zeit 1550 vor Christi Geburt erwähnt




66 Statistik die 5 Jahres Überlebensrate betrug in den 80er Jahren: Frauen 53 %Männer 35% 2004 betrug die Überlebensrate: Frauen 55%Männer 47%

67 Folgen des Tumorwachstums die meisten Patienten sterben nicht an der primären Tumorerkrankung, sondern an den Metastasen häufig betroffen sind: Leber, Lunge, Knochen, Gehirn, Lymphknoten Metastasen entstehen, indem sich Krebszellen vom Primärtumor ablösen

68 Folgen des Tumorwachstums schon sehr kleine Tumoren können metastasieren, z.B. beim Brustkrebs sind ab einem Tumordurchmesser von 1cm schon 20% metastasiert Voraussetzung für die Metastasierung: der Krebs wächst invasiv in angrenzende Strukturen mit Durchbruch in Blut- und Lymphgefäße

69 Folgen des Tumorwachstums Fähigkeit körpereigene Strukturen wie: die Basalmembran die Blut-Hirn-Schranke zu durchdringen aktiv in ein Gefäß einzudringen bezeichnet man als Invasion

70 Folgen des Tumorwachstums die Invasion ist eine aktive Leistung maligner Krebszellen abhängig von den jeweiligen genetischen Eigenschaften des Tumors wie verminderte Expression von Klebemolekülen auf der Zellmembran nur etwa 0,01% aller im Blut zirkulierenden Krebszellen schafft es eine metastatische Kolonie zu bilden

71 Folgen des Tumorwachstums bei der Anheftung spielen wieder andere Membranstrukturen so genannte Integrine = Eiweißmoleküle, welche Zellen verbinden- eine Rolle dieses Thema ist Gegenstand aktueller Forschungen

72 Folgen des Tumorwachstums Angiogenese Krebszellen sind im Gegensatz zu normalen Zellen in der Lage, umgebende Blutgefäße zum Ausspossen zu veranlassen Tumoren ohne diese angiogenetische Fähigkeit werden nicht Größer als 0,3mm

73 Folgen des Tumorwachstums Knochenabbau im Skelett müssen körpereigene Osteoklasten gezwungen werden Knochensubstanz abzubauen damit die Metastase wachsen kann

74 Metastasierung man unterscheidet gemäß der TNM- Klassifikation zwischen lokalen regionären- und Fernmetastasen

75 Metastasierung Lokale Metastasen entstehen in unmittelbarer Nähe des Primärtumors durch Verschleppung bösartiger Zellen in das umliegende Gewebe entsteht diese Verschleppung über Stichkanäle ( Biopsien ) oder Schnitte im Tumorgewebe spricht man von Impfmetastasen

76 Metastasierung regionäre Metastasen entstehen wenn Tumorzellverbände in die Lymphgefäße abschilfern, und sich in den ortsnahen Lymphknoten festsetzen Einteilung der Lympfknotenmetastasen durch N-Kategorie

77 Metastasierung Fernmetastasen entstehen, wenn Tumorzellverbände in Venen abschilfern und in entfernte Organe absiedeln werden auch hämatogene Metastasen genannt, und durch die M- Kategorie klassifiziert

78 Metastasierung manche Tumorarten metastasieren in ganz spezifische Organe so gut wie nie von Metastasen betroffen sind: Herz, Milz und Nieren grundsätzlich ist der Zielmechnismus nicht völlig verstanden

79 Metastasierungswege Lungentyp= arterieller Typ über das linke Herz in den großen Kreislauf : ZNS, Skelett, Leber, Nebennieren Bronchialkrebs

80 Metastasierungswege Hohlvenen= Kavatyp über die Hohlvene zur Lunge, weiter über den arteriellen Kreislauf : Skelett, Lunge, Gehirn, Leber Nieren-, Knochen-, Schilddrüsenkrebs

81 Metastasierungswege Pfortader- Typ über die Pfortader zur Leber, über die Hohlvene in den großen Kreislauf : Leber Krebs des Verdauungstraktes

82 Metastasierungswege Vertebralvenen-Typ über Verbindung zum Venensystem: Skelett, Wirbelsäule Brustkrebs, Prostatakrebs

83 TNM- System ist eine Klassifizierung von bösartigen Tumoren eignet sich nicht für Leukämien T Primärtumor Tis Tumor in situ / Frühform, Basalmembran intakt T1-T4 zunehmende lokale Ausdehnung N regionärer Lymphknotenbefall NO keine Anzeichen für Lymphknotenbefall N1-N3 zunehmender Lymphknotenbefall M Fernmetastasen

84 Grading Grad der Entartung: G = grading G1 = niedriger Malignitätsgrad, Zellen sind recht gut differenziert G2 = mittlerer Malignitätsgrad G3 = hoher Malignitätsgrad, Zellen kaum differenziert G4 = sehr hoher Malignitätsgrad, vollkommen entdifferenzierte Zellen

85 Resttumor Resttumor nach Operation wird mit R bezeichnet RO komplett entfernt R1 Resttumormasse vorhanden

86 Tumordiagnostik egal ob der Krebsverdacht aufgrund von Beschwerden oder einer Früherkennungsmaßnahme entstanden ist die ersten Beweise für das tatsächliche Vorhandensein eines Tumors liefern in der Regel bildgebende Verfahren: Röntgen, Ultraschall, CT, Kernspin Endoskopien bzw. Biopsien

87 Tumordiagnostik Programm zur gesetzlichen Früherkennung von Krebs in Deutschland für Frauen: Gebärmutterhalskrebs, ab dem 20. Lebensjahr 1x jährlich PAP-Abstrich Brustkrebs, ab dem 30. Lebensjahr 1x jährlich Abtastung der Brust incl. Achselhöhle, ab dem 50. Lebensjahr Mammographie alle zwei Jahre

88 Tumordiagnostik für Männer: Prostatakrebs, ab dem 45. Lebensjahr 1x jährlich Abtastung der Prostata vom Enddarm aus

89 Tumordiagnostik für Frauen und Männer: Hautkrebs, ab dem 35. Lebensjahr Untersuchung der Haut, einschließlich behaarter Kopfhaut, alle zwei Jahre Dickdarmkrebs, ab dem 50. Lebensjahr 1x jährlich digitale, rektale Austastung, plus Testbrief auf okkultes Blut ab dem 55. Lebensjahr eine Koloskopie, einmalige Wiederholung nach 10 Jahren möglich

90 Tumordiagnostik die Teilnahme ist freiwillig / Beratung vorgesehen für Frauen, die nach dem 31. 03. 1987 und Männer, die nach dem 31. 03. 1962 geboren sind gilt eine Beratungspflicht über Vor-und Nachteile der Vorsorgeuntersuchungen

91 Tumordiagnostik sollten gesetzlich versicherte Patienten an Krebs erkranken gilt dann die so genannte Chronikerregel= maximal 1 % des Bruttoeinkommens müssen für Arzneimittel und andere medizinische Leistungen selbst getragen werden, ohne Beratung müssen 2% Eigenanteil getragen werden

92 Tumormarker sind Bestandteile oder Stoffwechselprodukte von Tumorzelle weisen unterschiedliche Organspezifitäten auf wichtigste Bedeutung liegt in der Therapie- und Verlaufskontrolle Tumormarker, die mit verschiedenen Untersuchungsmethoden erstellt wurden, sind nicht vergleichbar vor Bestimmung Konsequenzen bedenken

93 Tumormarker AFP= wird physiologisch im Embryo gebildet primäres Leberzellkarzinom Keimzelltumoren von Hoden Eierstöcken immer parallel ß-hCG bestimmen auch erhöht bei Leberzirrhose

94 Tumormarker ß-hCG= Schwangerschaftserhaltendes Hormon außerhalb der Schwangerschaft: Chorionkarzinome= Keimzelltumoren zu 100% positiv

95 Tumormarker CA 15-3 Verlaufskontrolle des metastasierten Brustkrebses auch positiv bei Mastitis, Hepatitis, Pankreatitis

96 Tumormarker CA 72-4 Magenkrebs in Kombination mit CEA Ovarialkrebs in Kombination mit CA 125 selten positiv: entzündliche Prozesse Magen-Darmtrakt, Ovarien

97 Tumormarker CA 125 Verlaufskontrolle beim Ovarialkarzinom auch positiv bei Leberzirrhose akute Pankreatitis gutartige gynäkologische Entzündungen

98 Tumormarker CEA universeller Tumormarker, fast 80 % aller fortgeschrittenen Tumorerkrankungen zeigen erhöhte CEA- Werte Bestimmung immer zusammen mit einem Marker höherer Spezifität

99 Tumormarker Darm-, Magen-, Pankreas-, Brust-, Bronchial-, Uterus-, Zervix-,und Schilddrüsenkrebs auch positiv: bei Rauchern, Leberzirrhose, Colitis ulcerosa, Lungenemphysem 2-4 Wochen postoperativ durch entzündliche Veränderungen

100 Tumormarker PSA, freies PSA = Prostataspezifisches Antigen Prostatakarzinom Empfehlung für die Krebsvorsorge bei Männern ab 50 Jahren auch positiv: Prostataadenom Prostatitis

101 Tumormarker SCC = (squamous cell-antig) Plattenepithelkarzinom-Antigen der Zervix, der Lunge, der Speiseröhre, des Kopf-Hals-Bereichs auch positiv: entzündliche Lungenerkrankungen, Leberschäden, Hautexzeme, Schuppenflechte

102 Behandlungsverfahren bei Krebserkrankungen Ziel der Krebsbehandlung ist die Heilung= kurativer Ansatz oder das Langzeitüberleben des Patienten Prinzip: hit hard and early zeigt langfristig bessere Ergebnisse als weniger aggressives vorgehen

103 Behandlungsverfahren bei Krebserkrankungen manchmal ergibt sich schon bei der Diagnosestellung das eine Heilung nicht mehr möglich ist, hier spricht man von palliativer = Lebensverbessernder Therapie

104 Behandlungsverfahren bei Krebserkrankungen um einen Tumor komplett entfernen zu können, muss manchmal vor einer Operation mittels Strahlen - oder Chemotherapie eine Verkleinerung des Tumorgewebes versucht werden = neoadjuvante Therapie

105 Behandlungsverfahren bei Krebserkrankungen häufiger soll eine Nachbehandlung z.B. Resttumorzellen zerstören = adjuvante Therapie besteht die Möglichkeit den Tumor komplett zu entfernen, so erfolgt zunächst eine möglichst frühzeitige Operation

106 Behandlungsverfahren bei Krebserkrankungen benachbarte Lymphknoten werden entfernt, der so genannte Sentinel- Lymphknoten = Wächterlymphknoten = 1. Lymphknoten im Lymphabflussgebiet eines malignen Tumors wird insbesondere zu prognostischen Zwecken bei Brust- und Prostatakrebs gesucht

107 Behandlungsverfahren bei Krebserkrankungen auch wenn nur eine Verkleinerung des Tumorgewebes erreicht werden kann, kann die Operation im Sinne einer Palliation die Lebensqualität verbessern, z.B. bei einem Darmverschluss durch Tumorgewebe

108 Behandlungsverfahren bei Krebserkrankungen Strahlentherapie Ziel der Strahlentherapie ist, Tumorzellen zum Absterben zu bringen, meist soll das Risiko eines Lokalrezidivs vermindert werden, bei einigen Tumoren ist die Strahlentherapie alleinige Therapie, etwa bei Gehirntumoren die nicht entfernt werden können, hier werden höhere Dosen eingesetzt

109 Behandlungsverfahren bei Krebserkrankungen Strahlentherapie wird insbesondere auch in der Palliation bei Knochenmetastasen eingesetzt

110 Chemotherapie mit Zytostatika Zytostatika sind Zellgifte die Zellwachstum- und Vermehrung hemmen werden nur selten als alleinige Therapie eingesetzt häufig als adjuvante Therapie um Mikrometastasen zu behandeln

111 Chemotherapie mit Zytostatika seltener werden Zytostatika direkt in Körperhöhlen eingebracht, z. B. beim Blasentumor die Nebenwirkungen auf den Gesamtorganismus sind viel geringer

112 Chemotherapie mit Zytostatika meistens werden Zytostatika in mehrtägigen Chemotherapiezyklen verabreicht etwa alle 3 Wochen wiederholt gesunde Zellen erholen sich zwischen zwei Zyklen rascher als Tumorzellen, so dass Zytostatika stärker auf Tumorzellen, als auf gesunde Zellen wirken

113 Chemotherapie mit Zytostatika bei chronischen Leukämien werden niedrig dosierte Zytostatika als Dauerbehandlung verabreicht bei einer Hochdosis-Chemotherapie werden Zytostatika bis zu 30-mal höher dosiert, um möglichst alle bösartigen Zellen abzutöten, z.B. bei Leukämien vor einer Blutstamm-Zell-Transplantation

114 Chemotherapie mit Zytostatika diese Therapie ist recht riskant wegen der Schleimhautschädigung muss der Patient künstlich ernährt werden, bis sich die Zellen des Magen-Darm- Trakts erholt haben

115 Chemotherapie mit Zytostatika Allgemeine Nebenwirkungen der Chemotherapie Übelkeit, Erbrechen Ondansetron z.B Zofran Schleimhautenzündungen, Mundhöhle, Darm Venenreizungen bis hin zum Venenverschluss hier Portsystem sinnvoll, über Schlüsselbeinvene direkt in die Hohlvene, hier große Verdünnung

116 Chemotherapie mit Zytostatika Haarausfall Mangel an Blutkörperchen, im Sinne einer Panzytopenie Infektionsgefahr! leichtere Leukopenien können mit G-CSF ( Neupogen ) stimuliert werden Anämien werden mit Erythrozytenkonzentraten behandelt

117 Chemotherapie mit Zytostatika Dauerfolgen der Chemotherapie Unfruchtbarkeit, je nach Dauer und Aggressivität der Chemo-Therapie bei Männern : Samenspenden, bei Frauen: Tiefkühllagerung von Eierstockgewebe Männer und Frauen müssen während und nach der Therapie für mindestens 2 Jahre sicher verhüten

118 Chemotherapie mit Zytostatika Organschäden: dauerhafte Schädigungen des Herzmuskels durch Anthrazykline z.B. Epirubicin Polyneuropathien durch Alkaloide wie z. B. Taxol Zweittumoren durch ihre mögliche erbgutverändernden Eigenschaften, vor allem akute Leukämien, in der Kombination mit Strahlentherapie steigt das Risiko

119 Komplementärmedizin Hyperthermie: hier wird künstlich Fieber erzeugt mittels Ultraschall, Radio- oder Mikrowellen Hypertherme Perfusion: hier werden erwärmte Infusionen verabreicht, z.B. Zytostatika

120 Komplementärmedizin Therapeutische Ansatz: Tumorzellen sollen bei Temperaturen über 42 Grad direkt geschädigt werden Tumorzellen sollen wieder strahlensensibler werden, über eine Erweiterung der zuführenden Venen sollen Chemotherapeutika Krebszellen besser erreichen

121 Komplementärmedizin Misteltherapie verringert die Nebenwirkungen der Standarttherapie, Immunmodulierende Wirkung Thymustherapie Regulation des Immunsystems, insbesondere nach Chemotherapie, aktiviert T-Lymphozyten Reifung

122 Komplementärmedizin Falktor AF 2 Immunstimulierende Wirkung, Verbesserung der subjektiven Tumorbeschwerden auch während der Chemotherapie

123 Molekularer NK-Test NK Zellen können durch den Einsatz von Immunmodulatoren aktiviert werden auf die Stimulation schütten Zellen Zytokine wie Interleukine oder Tumor-Nekrose-Faktoren ( TNF ) aus welche wiederum NK-Zellen stimulieren

124 Molekularer NK-Test beim molekularen NK-Test isolieren wir NK-Zellen aus dem peripheren Blut, und inkubieren diese mit Interleukin 2 danach wird die Expression von Aktivierungsfaktoren wie z. B.TNF in den stimulierten, und nicht stimulierten NK-Zellen verglichen

125 Molekularer NK-Test ist die NK-Zelle grundsätzlich aktivierbar können verschiedene Immunstimulatien getestet werden Pflanzen: Mistelextrakten, Extrakten aus Echinacea oder Thuja Thymusextrakte: Thymosin, Thymojekt Peptide: AF 2

126 Zellulärer Immunstatus gibt Auskunft über die numerischen Verhältnisse und den Aktivierungszustand der Immunzellen im Blut

127 Zellulärer Immunstatus Die Bewertung erfolgt unter Berücksichtigung des Alters der Klinik ( Erkrankung, Therapie ) dem Verlauf, da geringe Veränderungen auch beim Gesunden auftreten

128 Zellulärer Immunstatus für eine funktionierende Immunabwehr sind eine Mindestmenge an Immunzellen notwendig Granulozyten Monozyten T- Lymphozyten B- Lymphozyten NK-Zellen

129 Zellulärer Immunstatus Verschiebungen der T- Helferzellen und T- Suppressorzellen = CD 4 / CD 8 - Ratio oder der NK-Zellen sind ein wichtiger Beitrag zur Diagnose / zur Verlaufskontrolle

130 Zellulärer Immunstatus Der zelluläre Aktivierungsgrad gibt Hinweise auf die Reaktionsfähigkeit der T-Zellen Aktivierte T-Zellen (prämitotisch, früh) = CD3 / CD 25+ Aktivierte T-Zellen (postmitotisch, spät) = CD3 / HLADR+


132 Zellulärer Immunstatus


134 Zytostatikagruppen Geschichte: während des 1. Weltkriegs stellten Ärzte fest, dass der Kampfstoff Schwefel-Lost ( Senfgas ) wachstumshemmende Wirkung hat 1942 erstmals als das weniger giftige Stickstoff-Lost eingesetzt

135 Zytostatikagruppen Zytostatische Wirkung der Platinkomplexe wurde 1965 zufällig bei einem Versuch mit Zellkulturen und einer Platinelektrode entdeckt andere Substanzen wurden in der Pharmaindustrie für völlig andere Bereiche entwickelt, fielen jedoch beim Tierversuch durch Wachstumshemmung auf

136 Zytostatikagruppen Alkylantien Übertragen Alkylgruppen auf die DNA zwei Stränge werden vernetzt = Hemmung der DNA Replikation Z.B. Cyclophosphamid, Ifofamid, Melphalan

137 Zytostatikagruppen Alkylantien sind terratogen, mutagen, karzinogen Übelkeit, Erbrechen Anämie Immunschwäche Lymphome, Leukämie, Brust-, Lungenkrebs, Hirntumore

138 Zytostatikagruppen Antimetaboliten werden als falsche Bausteine in die DNA oder RNA eingebaut stören Teilung und Stoffwechsel z.B. 5-Fluorouracil, Methotrexat

139 Zytostatikagruppen Antimetaboliten werden niedrig dosiert bei Warzen oder Rheuma eingesetzt haben vergleichsweise geringe NW Übelkeit, Erbrechen Hand-Fuß-Syndrom Anämie Nierenschäden solide Tumoren, Radiochemotherapie

140 Zytostatikagruppen Platinanaloga verursachen Quervernetzungen der DNA durch Bindung des Platinatoms an zwei Nukleinbasen z.B. Cisplatin, Carboplatin

141 Zytostatikagruppen Platine verursachen Übelkeit, Erbrechen Anämien Nierenschäden Nervenschäden Hoden-, Eierstockkrebs

142 Zytostatikagruppen Anthracycline sind Antibiotika verhindern die Nucleinsäuresynthese verursachen Doppelstrangbrüche der DNA verändern die Permeabilität der Zellmembran z.B. Epirubicin, Doxarubicin

143 Zytostatikagruppen Anthracycline verursachen schwere, teilweise irreversible Schäden Knochenmark Herz Brust-, Lungen-, Hoden-, Blasenkrebs AML, ALL

144 Zytostatikagruppen Mitosehemmstoffe sind Pflanzenstoffe Spindelgifte hemmen die Mitose z.B. Vinca- Alkaloide aus Madagaska- immergrün wie Vincristin Taxane aus der Eibe

145 Zytostatikagruppen Mitosehemmstoffe (Vincristin) verursachen: Übelkeit, Erbrechen Anämien Neurotoxisch Ovarial-, Brust-, Bronchialkrebs Lymphome, ALL

146 Zytostatikagruppen Taxane verursachen vielfältige NW: Übelkeit, Erbrechen fiebrige Neutropenie Verschluss des Tränenkanals neurotoxisch Hand -Fuß- Syndrom Fingernägel fallen ab Brust-, Ovarialkrebs

147 Zytostatikagruppen Topoisomerase – Hemmer Tpoisomerasen sind Enzyme, die an der Zellteilung direkt beteiligt sind und gehören chemisch verschiedenen Gruppen an werden alle aus giftigen Pflanzen gewonnen die Grundsubstanz stört die Topoisomerase I z.B. Etoposid, Teniposid

148 Zytostatikagruppen Topoisomerase – Hemmer verursachen starke Anämien Herzrasen Nieren- und Leberschäden sind neurotoxisch Lungen-, Hoden-, Ovarial-, Darmkrebs Lymphdrüsenkrebs

149 Zytostatikagruppen Monoklonale Antikörper bindet von der Zellaußenseite an den Wachstumsfaktor –Rezeptor HER 2 Antikörper-abhängige Zerstörung durch das Immunsystem wird nur bei Pat. mit nachgewiesener HER 2- Überexpression eingesetzt Herceptin

150 Immunstimulanzien Interferon alpha antiproliferierend und immunstärkend sind Zellhormone = Zytokine verursachen grippeähnliche Symptome, Übelkeit, Erbrechen Depressionen Melanom, CML

151 Hormonantagonisten blockieren Östrogenrezeptoren z.B. Tamoxifen häufig meno- und postpausal bei jungen Frauen GNR- Analoga z.B Zoladex aktuell Aromatasehemmer z.B. Letrozol Brustkrebs

152 Hormonantagonisten Voraussetzung ist ein positiver Rezeptorstatus wird in der Histologie festgelegt Tamoxifen: das Risiko von aggressiven, hormonunempfindlichen Zweittumoren ist deutlich erhöht ER+ = Östrogen Rezeptor positiv PR+ = Progesteron Rezeptor positiv

153 Angiogenesehemmer Sorafenib = Nexavar neuer Ansatz in der Krebstherapie unterbindet die Neubildung von Blutgefäßen Nierenzellkarzinom, Studien

154 Chemotherapien werden meistens als Kombinationen eingesetzt z.B. CMF, EC, Standards festgelegt / Tumorkonferenz Tumorzellisolierung / Chemoaustestung! second- / thirdline Therapien

Herunterladen ppt "Einführung in die schulmedizinische Tumortherapie."

Ähnliche Präsentationen
