Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Anfang des Kapitels Epigenetik und Genetik 18. GENETIK Epi-Genetik.

Ähnliche Präsentationen


Präsentation zum Thema: "Anfang des Kapitels Epigenetik und Genetik 18. GENETIK Epi-Genetik."—  Präsentation transkript:

1 Anfang des Kapitels Epigenetik und Genetik 18

2 GENETIK Epi-Genetik

3 EPIGENETIK Was ist Epigenetik? Genetik – Bauplan des Körpers Anweisung: Wie kann Nahrung verdaut werden? Anweisung: Wie kann Blutzucker reguliert werden? Anweisung: Welche Farbe sollten die Augen haben? Anweisung: Wie können starke Knochen aufgebaut werden? Gendefekt >> fehlende Funktion des Körpers >> Krankheit Epigenetik – „Lautstärkeregler“ für Gene Umwelteinflüsse schalten Gene ein (machen sie LAUTER) Umwelteinflüsse schalten Gene aus (machen sie LEISER) „Lautere“ und „Leisere“ Gene beeinflussen Prozesse im Körper Epigenetische Programmierung kann vererbt werden

4 EPIGENETIK Was ist Epigenetik? 1944 Niederlande Hungersnot 400kcal/Tag 1947 Niederlande 1997 Niederlande Herzkrankheit Brustkrebs Übergewicht 2013 Niederlande Herzkrankheit Brustkrebs Übergewicht Umwelteinfluss auf Mutter 1944 beeinflusst Gesundheit 2 Generationen später

5 GENETIK Wie funktioniert Epigenetik? GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG Laktose verdauen Heterochromatin

6 GENETIK Wie funktioniert Epigenetik? Hungersnot 400kcal/Tag Funktion A Funktion B Funktion C Funktion D Funktion E Funktion F

7 GENETIK Wie funktioniert Epigenetik?

8 GENETIK Wie funktioniert Epigenetik? GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG Laktose verdauen Wenn Epigenetik Gene ein- und ausschalten kann, übertrumpft sie dann nicht Gendefekte in ihrer Wirkung? Antwort: Manche Gendefekte zerstören die Anweisung für den Körper. Diese ist dann vollkommen verloren und kann nicht von Epigenetik gerettet werden. >> Genmutationen die schlimme Krankheiten auslösen

9 Ende des Kapitels Epigenetik und Genetik 18


Herunterladen ppt "Anfang des Kapitels Epigenetik und Genetik 18. GENETIK Epi-Genetik."

Ähnliche Präsentationen


Google-Anzeigen