Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Zentrum für Humangenetik Gentests zur Gesundheitsvorsorge www.DNAplus.de Name des Vortragenden.

Ähnliche Präsentationen


Präsentation zum Thema: "Zentrum für Humangenetik Gentests zur Gesundheitsvorsorge www.DNAplus.de Name des Vortragenden."—  Präsentation transkript:

1 Zentrum für Humangenetik Gentests zur Gesundheitsvorsorge Name des Vortragenden

2 EINLEITUNGWas sind Gene? Gene sind der Bauplan unseres Körpers DNAPLUS Pigment-Gen Laktose-Enzym-Gen T C A G A A G T C T G C T AGACTTTGCTAGACTTTGCTAACTTTGCTAG C G A TCTGAAACGATCTGAAACGATCGAAACGATC G C T AGACTTTGCTAGACTTTGCTAACTTTGCTAG C G A TCTGAAACGATCTGAAACGATCGAAACGATC Blaue Augen Laktose wird verdaut Zellkern Zelle (50bil) Gene Chromosom DNA Doppelhelix

3 DAS PROBLEMGendefekte Gendefekte können Krankheiten auslösen DNAPLUS Fehler oder MUTATIONEN ändern den genetischen Code TTGCTAGACTTTGCTAGACTTTGCTAGACTTTGCTAGACTTTGCTAGACTTTGCTAGACT AACGATCTGAAACGATCTGAAACGATCTGAAACGATCTGAAACGATCTGAAACGATCTGA Hemmt Blutgerinnselbildung Verdauung von Laktose Gerinnungs-Gen (Faktor V) Enzym-Gen(Laktase) Knochenaufbau-Gen(Col1A1) Starke Knochen TTGCTAGACTGTGCTAGACTTTGCTAGACTTTGCTAGACTTTGCTAGACTTTGCTAGACT AACGATCTGACACGATCTGAAACGATCTGAAACGATCTGAAACGATCTGAAACGATCTGA TTGCTAGACTGTGCTAGACTTTGCTAAACTTTGCTAGACTTTGCTAGACTTTGCTAGACT AACGATCTGACACGATCTGAAACGATTTGAAACGATCTGAAACGATCTGAAACGATCTGA TTGCTAGACTGTGCTAGACTTTGCTAAACTTTGCTAGACTTTGCTAGACTATGCTAGACT AACGATCTGACACGATCTGAAACGATTTGAAACGATCTGAAACGATCTGATACGATCTGA Thrombose Laktose Intoleranz Osteoporose Jeder trägt etwa Gendefekte in sich Welche Rolle spiele Gene bei Übergewicht? Dazu ein Beisspiel:

4 ÜBERGEWICHTDie Unterschiede bei Übergewicht Jeder Mensch reagiert anders auf Diäten und Sport DNAPLUS 75kg 70kg Sabrina Martina Alina Karina Viele Jahre 75kg Sabrina Martina Alina Karina Koh- Fett- PPARG

5 ÜBERGEWICHTDie Unterschiede bei Übergewicht Abnehmen durch Sport DNAPLUS 75kg 70kg 75kg Sabrina Martina Alina Karina PPARG Spo- Spo+ 6 Monate (4x Sport für 30 min) 6 Monate (4x Sport für 30 min) Spo+ Sabrina Martina Alina Karina 60kg -15Kg 65kg -10Kg 60kg -10Kg 70kg -5Kg Spo+ Spo- Spo+ Spo- ADRB3FTO

6 ÜBERGEWICHTDie Unterschiede bei Übergewicht Abnehmen durch Sport DNAPLUS 75kg 70kg 75kg Sabrina Martina Alina Karina 6 Monate (4x Sport für 30 min) 6 Monate (4x Sport für 30 min) Sabrina Martina Alina Karina 60kg -15Kg 65kg -10Kg 60kg -10Kg 70kg -5Kg Sport x2 Sport x4 60kg -15Kg 60kg -15Kg

7 ÜBERGEWICHTDie Unterschiede bei Übergewicht Der Jo-Jo Effekt DNAPLUS 75kg Sabrina Alina Karina 60kg -15Kg 60kg -10Kg 60kg -15Kg 60kg -15Kg Sabrina Martina Alina Karina Martina JoJo- JoJo+ JoJo- JoJo+ PPARGADRB2aADRB2b

8 ÜBERGEWICHTDie Unterschiede bei Übergewicht Abnehmen durch Kalorien-Reduktion DNAPLUS 75kg Sabrina Martina Alina Karina 6 Monate Diät -20% der Kalorien 6 Monate Diät -20% der Kalorien Sabrina Martina Alina Karina 70kg -5Kg 60kg -15Kg 65kg -10Kg 60kg -15Kg Kal- Kal+ Kal- Kal+ Kal- Kal+ PPARGADRB2bAPOA5

9 ÜBERGEWICHTDie Unterschiede bei Übergewicht Abnehmen durch Kalorienreduktion DNAPLUS 75kg Sabrina Martina Alina Karina 6 Monate Diät -20% der Kalorien 6 Monate Diät -20% der Kalorien Sabrina Martina Alina Karina 70kg -5Kg 60kg -15Kg 65kg -10Kg 60kg -15Kg 60kg -15Kg 60kg -15Kg -40% Kalorien -30% Kalorien

10 ÜBERGEWICHTDie Unterschiede bei Übergewicht Fehlende Disziplin DNAPLUS

11 ÜBERGEWICHTDie Unterschiede bei Übergewicht Für jeden das optimale Programm DNAPLUS 75kg Sabrina Martina Alina Karina -- Kohlenhydrate, ++Sport, +- Kalorien -- Kohlenhydrate, ++Sport, +- Kalorien -- Kohlenhydrate, -- Kalorien, +-Sport -- Kohlenhydrate, -- Kalorien, +-Sport -- Fett, +- Kalorien, ++Sport -- Fett, +- Kalorien, ++Sport -- Kohlenhydrate, -- Kalorien, +-Sport -- Kohlenhydrate, -- Kalorien, +-Sport 60kg -15Kg 60kg -15Kg 60kg -15Kg 60kg -15Kg

12 ÜBERGEWICHTDie Unterschiede bei Übergewicht Fortschritte der Humangenetik DNAPLUS

13 ÜBERGEWICHTDie Unterschiede bei Übergewicht Jeder Mensch reagiert anders auf Diäten und Sport DNAPLUS

14 ÜBERGEWICHTDie Unterschiede bei Übergewicht Jeder Mensch reagiert anders auf Diäten und Sport DNAPLUS

15 ÜBERGEWICHTDie Unterschiede bei Übergewicht Jeder Mensch reagiert anders auf Diäten und Sport DNAPLUS

16 ÜBERGEWICHTDas Konzept hinter dem Programm Die genetischen Stärken werden ausgenutzt DNAPLUS Sport oder Kalorienreduktion?

17 ÜBERGEWICHTDas Konzept hinter dem Programm Die genetischen Stärken werden ausgenutzt DNAPLUS

18 ABLAUFAblauf im Programm Die Nahrungstabelle DNAPLUS Hier ist Fett ein Risiko Faktor, Kohlenhydrate sind kein Problem. Deshalb ist alles was Fett enthält Übergewichtsfördernd. Empfehlung: Anhand der Liste heraussuchen was nicht oder wenig übergewichtsfördernd ist und einem trotzdem schmeckt und die Ernährung dementsprechend umstellen. Beispiel: Diese Person isst gerne Spagetti Bolognese (KH) sowie auch Speck (FETT). Lösung: Weniger Speck aber dafür mehr Spaghetti >>> Einfach einzuhalten

19 ABLAUFAblauf im Programm Die drei Phasen DNAPLUS Abnahme Anpassung Stabilitäts phase Kg Zeit

20 DER ABLAUFDas Speichelprobenset Die Gene werden aus dem Speichel extrahiert DNAPLUS

21 DAS ERGEBNISDie Antworten Folgende Fragen werden durch die Analyse beantwortet DNAPLUS Ihre genetische Neigung zu Übergewicht Führt Fett bei Ihnen zu Übergewicht? Wie schwer fällt Ihnen das Abnehmen? Wie stark ist bei Ihnen der Jo-Jo-Effekt? Wird bei Ihnen vermehrt Fett um die Organe abgelagert? Wie intensiv ist Ihr Hungergefühl? Wie intensiv ist Ihr Sättigungsgefühl? Tendieren Sie aufgrund Ihrer Gene dazu, besonders kalorienreich zu essen? Tendieren Sie aufgrund Ihrer Gene dazu, mehrere kleine Snacks zu essen? Wie effektiv ist eine Kalorienreduktion zum Abnehmen (weniger essen)? Wie viel Muskelmasse verlieren Sie durch eine Kalorienreduktion? Wie leicht nehmen Sie durch Sport ab und wie viel Sport ist optimal für Sie? Verbessert regelmäßiger Sport Ihre Gen-Eigenschaften? Was dürfen Sie ohne Probleme essen und was sollten Sie unbedingt meiden?

22 DAS ERGEBNISDie Vorteile durch die Analyse Die Vorteile DNAPLUS Schon vorher wissen was sie dick macht Das essen können was einem schmeckt Angeborene Stärken nützen um einfach abzunehmen Deine Schwächen meiden um schlank zu werden und bleiben Eine Genanalyse mit lebenslanger Gültigkeit (funktioniert auch in zehn Jahren noch) Im Durchschnitt 2,5 mal mehr abnehmen ( durch Studie belegt) Abnahmeerfolg mit Standardprogramm:5 kg Abnahmeerfolg durch Gen-individuelles Programm:12,5kg

23 DAS ERGEBNISDer Leistungsumfang Folgendes Erhalten Sie mit jeder Genanalyse DNAPLUS Analyse der 8 relevanten Gene Auswertung ihrer angeborenen Eigenschaften Ein auf Ihre Gene angepasste Abnahmeprogramm Mehr als 600 Nahrungsmittel nach ihren Genen bewertet Bericht mit etwa 60 Seiten

24 Zentrum für Humangenetik Vielen Dank für Ihre Aufmerksamkeit Name des Vortragenden


Herunterladen ppt "Zentrum für Humangenetik Gentests zur Gesundheitsvorsorge www.DNAplus.de Name des Vortragenden."

Ähnliche Präsentationen


Google-Anzeigen