Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Anfang des Kapitels Was sind Gene und was kann uns eine Genanalyse sagen? 13.

Ähnliche Präsentationen


Präsentation zum Thema: "Anfang des Kapitels Was sind Gene und was kann uns eine Genanalyse sagen? 13."—  Präsentation transkript:

1

2 Anfang des Kapitels Was sind Gene und was kann uns eine Genanalyse sagen? 13

3 GENETIK Was sind Gene?

4 Menschlicher Körper Zellen (50 bil) Chromosom DNA Doppelhelix Pigment-Gen GENETIK Was sind Gene? Blaue Augen

5 Ende des Kapitels Was sind Gene? 13

6 Anfang des Kapitels Was kann uns eine Genanalyse sagen? 14

7 GENETIK Was sagt uns eine Genanalyse?

8 GENETIK Was sind Gene? Starke Knochen Verdauung von Laktose Hemmt Blutgerinnselbildung Fehler oder MUTATIONEN ändern den genetischen Code Jeder trägt etwa Gendefekte in sich Thrombose Laktose Intoleranz Osteoporose Gerinnungs-Gen (Faktor V) Enzym-Gen(Laktase) Knochenaufbau-Gen(Col1A1) TTGCTAGACTGTGCTAGACTTTGCTAAACTTTGCTAGACTTTGCTAGACTATGCTAGACT AACGATCTGACACGATCTGAAACGATTTGAAACGATCTGAAACGATCTGATACGATCTGA TTGCTAGACTGTGCTAGACTTTGCTAAACTTTGCTAGACTTTGCTAGACTATGCTAGACT AACGATCTGACACGATCTGAAACGATTTGAAACGATCTGAAACGATCTGATACGATCTGA

9 GENETIK Wie entstehen Mutationen? ATTAGGGTGGTACCGTTGCCGGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCATCTTCGGGAAAATATTGTTTT RadioaktivitätUV-StrahlungKopierfehlerRuß/Rauch Ca. 3 pro Generation

10 GENETIK Auswirkungen von Mutationen ATTCGCGGCTTATTAGGCCGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCTCGATCTTCGGGAAAATATTGTTTT Gerinnungs-Gen (Faktor V) Laktose-Enzym-Gen(Laktase)Fettaufnahme-Gen(FABP2)Eisenaufnahme-Gen(HFE)Nierengewebe-Gen(COL4A5) Verhindert Blutgerinnsel- bildung in den Gefäßen Spaltet Laktose im Darm Baut starkes Nierengewebe auf Reguliert die Fettaufnahme aus der Nahrung Reguliert die Eisenaufnahme aus der Nahrung

11 GENETIK ATTCGGTTGTTGCGGCTTATTAGGCCGGGGCTTAATATCGCTTATGAAACCATCGG Nierengewebe-Gen(COL4A5) Baut starkes Nierengewebe auf G Auswirkungen von Mutationen

12 GENETIK ATTCGGTTGTTGCGGCTTATTAGGCCGGGGCTTAATATCGCTTATGAAACCATCGG Nierengewebe-Gen(COL4A5) Baut starkes Nierengewebe auf G Nierenversagen ??? Genanalyse (€1500) Diagnose (ALPORT SYNDROM) 1 von Auswirkungen von Mutationen

13 GENETIK Häufige Krankheiten Seltene Krankheiten Medikamente Körpergewicht Ernährung Leistungssport Talente Auswirkungen von Mutationen

14 GENETIK Was sind Polymorphismen? ATTAGGGTGGTACCGTTGCCGGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCATCTTCGGGAAAATATTGTTTT Etwa alle Basen ein Unterscheid ATTAGGGTGGTACCATTGCCGGGGGCTTAATATCGCTTATGAAACGATCGGTCTCGGGAATTCTCGGATATTTGGTTCTTCGGCGCGATTCGGATAATATCATCTTCGGGAAAATATTGGTTT Etwa alle 100 Basen ein Unterscheid

15 GENETIK ATTAGGGTGGTACCGTTGCCGGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCATCTTCGGGAAAATATTGTTTT ATTAGGGTGGTACCATTGCCGGGGGCTTAATATCGCTTATGAAACGATCGGTCTCGGGAATTCTCGGATATTTGGTTCTTCGGCGCGATTCGGATAATATCATCTTCGGGAAAATATTGGTTT Single Nucleotide Polymorphismen (SNPs / „SNIPS“) Sehr häufig ca. 10 Mio bekannt Großteil ohne Auswirkung ca pro Person, die die Gesundheit negativ beeinflussen Ein häufiges Beispiel Was sind Polymorphismen?

16 GENETIK Laktose-(in)Toleranz GA L GLU LAKTOSE Laktase-Gen GLU GA L

17 GENETIK GA L GLU LAKTOSE Laktase-Gen GLU GA L LAKTOSE Alter++ Laktose-(in)Toleranz

18 GENETIK Mittlere Symptome Schwere Symptome Leichte SymptomeLaktose-Enzym Alter (Jahre) von 6 Europäer: Laktase-Enzym wird allmählich abgeschalten Laktose Intoleranz Laktose-(in)Toleranz

19 GENETIK GA L GLU LAKTOSE Laktase-Gen GLU GA L LAKTOSE Alter++ SNP Laktose-(in)Toleranz

20 GENETIK Mittlere Symptome Schwere Symptome Leichte SymptomeLaktose-Enzym Alter (Jahre) von 6 Europäer: Laktose-Enzym wird konstant produziert 1 von 6 Europäer: Laktose-Enzym wird allmählich abgeschalten Laktose Intoleranz Laktose-(in)Toleranz

21 GENETIK Laktose-(in)Toleranz

22 GENETIK Laktose-(in)Toleranz

23 GENETIK Laktose-(in)Toleranz

24 GENETIK Eisenspeicherkrankheit und Prävention Eisen im Blut Alter (Jahre) Infektanfälligkeit Gelenkschmerzen Diabetes Leberzhirrose Zhirrose, Diabetes etc. bestehen Gentest Zu 76% Fehldiagnostiziert!! Aderlass-Therapie Üblicher Ablauf

25 GENETIK Eisen im Blut Alter (Jahre) Infektanfälligkeit Gelenkschmerzen Diabetes Leberzhirrose Gentest Aderlass-Therapie Üblicher Ablauf Gentest Gesund 4-6x Jährlich Blutspenden Eisenspeicherkrankheit und Prävention

26 GENETIK Häufige Krankheiten Seltene Krankheiten Medikamente Körpergewicht Ernährung Leistungssport Talente Auswirkungen von Mutationen

27 GENETIK Pharmakogenetik – Medikamente und Nebenwirkungen Medikamente wirken nur bei 60% der Population wie gewünscht >>>Nebenwirkungen (Tödlich) >>>Keine Wirkung Einer von 12 Klinikpatienten erleiden schwere Nebenwirkungen Einer von 250 Klinikpatienten stirbt daran Die fünft häufigste Todesursache der westlichen Welt Mehr als Tote pro Jahr (USA) Gene steuern den Abbau von Medikamenten CYP 2D6, CYP 2C9, CYP 2C19

28 GENETIK Medikament wird eingenommen Medikament wird von Enzym zum Abbau vorbereitet Medikament landet im Urin Enzym-Gen Medikament zeigt seine Wirkung Pharmakogenetik

29 GENETIK Wirkungsbereich des Medikaments Medikament im Blut Zeit (Tage) 1d 2d 3d 4d Einnahme Ein Medikament wird ins Blut aufgenommen und wieder herausgefiltert. Für dauerhafte Wirkung wird es täglich eingenommen Pharmakogenetik

30 GENETIK Medikament wird eingenommen Medikament wird nicht abgebaut Enzym-Gen Medikament zeigt seine Wirkung Medikament wird nicht aus dem Körper gefiltert Beispiel Warfarin Pharmakogenetik

31 GENETIK Wirkungsbereich des Medikaments Medikament im Blut Zeit (Tage) 1d 2d 3d 4d Einnahme NEBENWIRKUNGEN Pharmakogenetik

32 GENETIK Häufige Krankheiten Seltene Krankheiten Medikamente Körpergewicht Ernährung Leistungssport Talente Auswirkungen von Mutationen

33 GENETIK Fettaufnahme-Gen FETT Genetik von Übergewicht

34 GENETIK Fettaufnahme-Gen FETT Genetik von Übergewicht FETT

35 GENETIK LOW FAT LOW CARB BALANCED, WENIG FETT BALANCED, WENIG KOHLENHYDRATE BALANCED ? AM EFFEKTIVSTEN Genetik von Übergewicht

36 GENETIK Häufige Krankheiten Seltene Krankheiten Medikamente Körpergewicht Ernährung Leistungssport Talente Auswirkungen von Mutationen

37 GENETIK Ernährungsgenetik Laktose intolerant Gluten intolerant Eisenspeicherkrankheit MilchprodukteWeizenRotes Fleisch Für Jeden treffen andere Ernährungsempfehlungen zu!

38 GENETIK Häufige Krankheiten Seltene Krankheiten Medikamente Körpergewicht Ernährung Leistungssport Talente Auswirkungen von Mutationen

39 GENETIK Gene und Leistungssport 14% Kontrollgruppe Kraft-Gene 3% Athleten (WM/Olympia) 5x schlechtere Chance in die WM-Liga zu kommen AUS KRA AUS KRA

40 GENETIK Häufige Krankheiten Seltene Krankheiten Medikamente Körpergewicht Ernährung Leistungssport Talente Die verschiedenen Analysekategorien LIFESTYLE ANALYSEN MEDIZINISCHE ANALYSEN SPEZIALFÄLLE

41 Ende des Kapitels Was kann uns eine Genanalyse sagen? 14


Herunterladen ppt "Anfang des Kapitels Was sind Gene und was kann uns eine Genanalyse sagen? 13."

Ähnliche Präsentationen


Google-Anzeigen