Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Molekulargenetische Diagnostik  Segregationsanalysen (indirekte Diagnostik)  monogene Erkrankung (Retinoblastom)  genetisch heterogene Erkrankung (multiple.

Ähnliche Präsentationen


Präsentation zum Thema: "Molekulargenetische Diagnostik  Segregationsanalysen (indirekte Diagnostik)  monogene Erkrankung (Retinoblastom)  genetisch heterogene Erkrankung (multiple."—  Präsentation transkript:

1 Molekulargenetische Diagnostik  Segregationsanalysen (indirekte Diagnostik)  monogene Erkrankung (Retinoblastom)  genetisch heterogene Erkrankung (multiple kartilaginäre Exostosen)  DNA-Sequenzanalyse (direkte Diagnostik) (Tricho-Rhino-Phalangeales Syndrom)  MLPA (direkte Diagnostik, Retinoblastom) (D. Lohmann) H.-J. Lüdecke

2 Retinoblastom

3 Familienanamnese bei Retinoblastom Familie L.S.Familie J.W. Familie L.B.

4 Erbliches Retinoblastom rbrb rb rb RBrb RB rb rb RB rb X RB TumorkonstitutionellKeimbahn rb RB Gameten erste Mutation zweite Mutation

5 Retinoblastomgen ´3´ Genomische DNA ExonIntron Beispiele für Mutationen in kodierenden Bereichen

6 Segregation

7 Indirekte Diagnostik: Segregation gekoppelter Marker

8 VNTR-Polymorphismus ggtgtacgtc tatacagggc tatgtataac cgactcctgt ttctcctccc tgcaaccaca gaaccatcac acacacacac acacacacac acacacacac acacacacac acacggatac acgcacagat acgctccttt ccacaaatgc acgcaaaccg ggacgcaaac ccacaactcg agggcttaga ccttcactgc 5´3´

9 ... CTTT GAAA... Intragene VNTR-Loci 5´3´ D13S153 (RBi2) RB CA GT... nn VNTR-Loci

10 Genotypisierung RB1, väterliches AllelRB1, mütterliches Allel CA GT 20 CTTT GAAA 14 CA GT 18 CTTT GAAA 19

11 Kopplungsphase RB1, mutiert CTTT GAAA 14 CTTT GAAA 19 4bp Deletion Exon 4

12 Kopplungsphase Rb1.20- Genotyp

13 Kopplungsphase Rb1.20- Genotyp CTTT GAAA 14 4bp Deletion Exon 4

14 Analyse von VNTR-Loci 5´3´ PCR Fragmentlängenanalyse durch elektrophoretische Auftrennung oder

15 Gelektrophorese

16 Agarosegel in Elektrophresekammer Kathode (+) Anode (–)

17 Auftragen der Proben

18 Elektrophoretische Auftrennung

19 Dokumentation per Videobild

20 Dokumentation

21 Genotypisierung Rb1.20- Genotyp I-1I-2II-2II-3III-1

22 Familie I

23

24 Familie I

25 Familie I

26 Familie I

27 Familie I

28 Familie

29 Familie

30 Familie

31 Prädiktive Diagnostik bei Locusheterogenität Segregationsanalyse bei hereditären multiplen cartilaginären Exostosen (HME) Hermann-Josef Lüdecke

32

33

34 Lokalisierung der Exostosen

35 Multiple cartilaginäre Exostosen  Häufigkeit1 :  Penetranz  100 %  autosomal dominant  genetisch heterogen 8q24.1EXT1 11p11-12EXT2 (19pEXT3)

36 Spektrum der Mutationen in EXT1 und EXT2 Wuyts & van Hul, 2000

37 Kopplungsanalyse und Segregationsanalyse mit EXT1- bzw. EXT2- intragenen EXT1- bzw. EXT2- intragenen Mikrosatelliten-Markern Mikrosatelliten-Markern

38 genomische Organisation des EXT1-Gens “EXT1“

39 Kopplungsphase: Risiko: P P P GP P P EXT2, Allel 2 M P kein Risiko

40 Übungsaufgaben

41 P P EXT1, Allel 2 P kein Risiko für III2

42 PP PP keine Aussage möglich

43 P P EXT2, Allel 2 P Individuum III2 wird erkranken

44 PP P MM M M M P ? P ? Fehlen paternaler EXT1-Allele

45 y935A12 y960B10

46 der(8) der(5) Sonde: "paint 5"Sonde: y960B10

47 Molekulargenetische Diagnostik durch DNA- Sequenzanalyse

48 Punktmutationen THE CAT DID EAT THE RED HAT THE RAT DID EAT THE RED HAT THE ATD IDE ATT HER EDH AT THE CHA TDI DEA TTH ERE DHA T

49 1. Enzymatische Vermehrung des zu untersuchenden Genabschnittes mittels PCR Cave: Es werden immer das maternale und paternale gemeinsam amplifiziert!

50 2. Enzymatische Sequenzierung nach Sanger Template (Matrize) 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' Primer (Startmolekül) 5'-AAGTCATTGC-3' 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC-3' Primer-Annealing (Anlagerung) DNA-Polymerase dNTPs dd A TP, dd G TP, dd C TP, dd T TP Primer-Verlängerung und Kettenabbruch

51

52 Enzymatische Sequenzierung nach Sanger Template (Matrize, einzelsträngig) 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' Primer (Startmolekül) 5'-AAGTCATTGC-3' 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC-3' 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC Primer-Annealing (Anlagerung) DNA-Polymerase dNTPs dd A TP, dd G TP, dd C TP, dd T TP Primer-Verlängerung und Kettenabbruch TACGTAAC T TACGTAACT G TACGTAACTG A 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC TACGTAACTGA C

53 Enzymatische Sequenzierung nach Sanger 3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5' 5'-AAGTCATTGC-3' 5'-AAGTCATTGCTACG T DNA-Polymerase dNTPs dd A TP, dd G TP, dd C TP, dd T TP Primer-Verlängerung und Kettenabbruch 5'-AAGTCATTGCTACGTA A 5'-AAGTCATTGCTACGTAA C hier sind einmal alle Produkte der Primer-Verlängerung gezeigt: 5'-AAGTCATTGC T 5'-AAGTCATTGCT A 5'-AAGTCATTGCTA C 5'-AAGTCATTGCTAC G 5'-AAGTCATTGCTACGT A 5'-AAGTCATTGCTACGTAAC T 5'-AAGTCATTGCTACGTAACT G 5'-AAGTCATTGCTACGTAACTG A usw.

54

55 GelelektrophoreseKapillarelektrophorese

56 manuelle Beladung der Geleautomatische Beladung der Kapillaren

57

58 AGCTATAATTGTCAGTTCTGTGACTTCNGATATTCCAAAAGC AGCTATAATTGTCAGTTCTGTGACTTCCGATATTCCAAAAGC Patient Normalperson CGATGACGATGA

59

60 Klinische Zeichen: dünnes, spärliches Kopfhaar dünnes, spärliches Kopfhaar große, "birnenförmige" Nase große, "birnenförmige" Nase langes, flaches Philtrum langes, flaches Philtrum schmales Oberlippenrot schmales Oberlippenrot Zapfenepiphysen Zapfenepiphysen Brachydaktylie Brachydaktylie Hüftveränderungen Hüftveränderungen Kleinwuchs Kleinwuchs multiple cartilaginäre Exostosen (nur TRPS II) multiple cartilaginäre Exostosen (nur TRPS II) Tricho-Rhino-Phalangeale Syndrome 8TRPS1EXT1

61 Tricho-Rhino-Phalangeales Syndrom An dieser Stelle wurde im Praktikum das Foto einer Patientin gezeigt. Dieses darf jedoch nicht im Internet veröffentlicht werden. Ich hoffe, Sie haben sich die Charakteristika des TRPS einprägen können.

62

63

64 N C Struktur des TRPS1 Transkriptionsfaktors Exon 6

65 Sequenzierung von Exon 6 des TRPS1-Gens CGA  CAA; Arg  Gln; R  Q

66 Übungsaufgaben

67 Patient 1 Normalperson CCGGTGTTTTTTGTGCCAATTGCCTGNCCACAAAGACCTCTC CCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTC ACC CCC

68

69 Normalperson CCGGTGTTTTTTGTGCCAATTGCCTGNCCACAAAGACCTCTC CCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTC ACC CCC = Thr = Pro

70 R R R G S G V F C A N C L T T K T S L W R K N A N G G Y V C N A C G L Y Q K L H S Zn P NH 2 COOH Struktur des Zinkfingers vom "GATA"-Typ

71 aus: Vilain et al. (1999) Am J Med Genet 85:

72 Patient 2 Normalperson CAGAGGCGTAGAGGCTCCGGTGTTTTTTNGGNCCATTGNCNN CAGAGGCGTAGAGGCTCCGGTGTTTTTTGTGCCAATTGCCTG

73 Normalperson CAGAGGCGTAGAGGCTCCGGTGTTTTTTGTGCCAATTGCCTG TGTGCCAATTGCCT GTGCCAATTGCCTG CAGAGGCGTAGAGGCTCCGGTGTTTTTTNGGNCCATTGNCNN Wildtyp: mutant: T-Insertion

74 Patient 3 Normalperson CTCTGGCGAAAGAATGCAAATGGCGGATANGTATGCAACGCGT CTCTGGCGAAAGAATGCAAATGGCGGATATGTATGCAACGCGT TAT TAA = Stop

75 Patient 4 Normalperson AAGCTTCACTCGNTAAGAACTTGTTCCACTCTTTCAGGAAAA AAGCTTCACTCGGTAAGAACTTGTTCCACTCTTTCAGGAAAA gtaaga ttaaga

76 RNA - SpleissenWildtyp Mutation eines Spleiss-Signals

77 N C IVS6+1G>T   exon6-TRPS N C 1281 aa 1240 aa Wildtyp-TRPS1

78 M ultiplex L igation-dependent P robe A mplication (MLPA)

79 SALSA MLPA probes

80 Hybridisierung 1.Der MLPA Sondenmix wird zu denaturierter genomischer DNA gegeben 2.Die zwei Teile jeder Sonde hybridisieren mit benachbarten Zielsequenzen Beachte den Unterschied

81 Ligation 3. Die Sonden werden mit Hilfe einer thermostabilen Ligase verbunden (ligiert)

82 Amplification 4.Mit einem universellen Primerpaar kann man alle ligierten Sonden amplifizieren Das Amplifikationsprodukt jeder einzelnen Sonde hat eine genau definierte Länge ( bp). Fluoreszenzfarbstoff

83 bp NP1 NP2 Patient 1 Patient 2 Patient


Herunterladen ppt "Molekulargenetische Diagnostik  Segregationsanalysen (indirekte Diagnostik)  monogene Erkrankung (Retinoblastom)  genetisch heterogene Erkrankung (multiple."

Ähnliche Präsentationen


Google-Anzeigen