Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 1 EST: Expressed Sequence Tag Teil einer copy DNA (cDNA) - Nukleotidsequenz.

Ähnliche Präsentationen


Präsentation zum Thema: "Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 1 EST: Expressed Sequence Tag Teil einer copy DNA (cDNA) - Nukleotidsequenz."—  Präsentation transkript:

1 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 1 EST: Expressed Sequence Tag Teil einer copy DNA (cDNA) - Nukleotidsequenz Entwicklung einer cDNA aus einer mRNA mittels Reverse- Transkriptase (eigentlich keine Introns) Expressionsanalyse durch cDNA Extraktion von mRNA aus jeweiligen Zellen

2 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 2 ATCC AAT CGCCAATGCG CATC GGCCTCCCGAAAAAAA DNA 3 5 Zelle 5 3 mRNA UAGGGCGGUUACGCCCGGAGGGCTTTTTTT Transkription EST-Entwicklung I

3 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 3 Glasschale Flüssigkeit + Enzym Nukleotide EST-Entwicklung II Zelle mRNA Extraktion der mRNA cDNA Reverse-Transkription

4 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 4 EST-Entwicklung III ATCC AAT CGCCAATGCG CATC GGCCTCCCGAAAAAAA DNA mRNA UAGGGCGGUUACGCCCGGAGGGCUUUUU U Transkription ATCCCGCCAATGCGGGCCTCCCGAAAAAAA cDNA 3 5 Reverse-Transkriptase Plasmide Bakterie Chromosom DNA Plasmid-Nukleotidsequenz

5 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 5 EST-Entwicklung IV Teilung 3 mal pro Stunde -> h 10 8 bis Bakterien

6 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 6 EST-Entwicklung V

7 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 7 EST-Entwicklung VI Glasschale Flüssigkeit + Enzym Nukleotide normale und pigmentierte cDNA Vector

8 Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 8 EST-Entwicklung VII ATCCCGCCAA T ATCCCGCCAATGCGG G ATCCCGCCAATGCGGGCC T ATCCCG C ATCCCGCCA A ESTs


Herunterladen ppt "Übung: Einführung in die Bioinformatik U. Scholz & M. Lange Übung 1: ESTs # 1 EST: Expressed Sequence Tag Teil einer copy DNA (cDNA) - Nukleotidsequenz."

Ähnliche Präsentationen


Google-Anzeigen