Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

1 GDV Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung FfM., den 05.06.2003 Oleg Rempel und Sven Zöller Johann Wolfgang Goethe-Universität.

Ähnliche Präsentationen


Präsentation zum Thema: "1 GDV Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung FfM., den 05.06.2003 Oleg Rempel und Sven Zöller Johann Wolfgang Goethe-Universität."—  Präsentation transkript:

1 1 GDV Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung FfM., den Oleg Rempel und Sven Zöller Johann Wolfgang Goethe-Universität Frankfurt am Main

2 2 1 Einleitung 1.1 Exkurs ins menschlichen Genom 1.2 Human Genom Projekt 2 Graphisches Darstellen von Genomen 2.1 Ziele 2.2 Probleme 3 ProtAnnot und Neomorphic GeneViewer 3.1 Hintergrund 3.2 Semantisches Zooming 3.3 Zweidimensionales Zooming 3.4 Einzelne oder doppelte Reihenfolge der Genstruktur 3.5 Umgang mit der Komplexität der Informationen 3.6 Proteinvorhersage 4 Beispiel SeqVISTA 4.1 Hintergrund 4.2 SeqVISTA 4.3 repetitive Elemente 4.4 Proteinstruktur 5 Zusammenfassung Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Gliederung

3 3 1 Einleitung 1.1 Exkurs ins menschliche Genom Genom (Erbgut) ist die Gesamtheit der Erbinformation einer Zelle. Die Erbinformation ist die in der DNA jeder Zelle gespeicherte Information zur Ausbildung von Merkmalen. Unter Merkmalen versteht man die Entwicklung, das Aussehen, das Verhalten, die Gesundheit und die Neigung zu bestimmten Krankheiten. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Genom als der Bauplan des Lebens

4 4 1 Einleitung 1.1 Exkurs ins menschliche Genom Jede Zelle des menschlichen Organismus besitzt das komplette Genom. Das meiste menschliche Genom (99,9995%) befindet sich im Zellkern. Rest (0,0005%) in Mitochondrien der Zelle. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Sitz des Genoms

5 5 1 Einleitung 1.1 Exkurs ins menschliche Genom Erbsubstanz der Erbinformation ist die DNA (DesoxyriboNucleid Acid). Die DNA besteht aus Bausteinen (Nukleotiden ), die in zwei komplementär angeordneten Strängen miteinander Verknüpft sind. Die beiden DNA-Stränge sind spiralförmig um die eigene Achse gewunden, bilden so genannte Doppelhelix. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung DNA

6 6 1 Einleitung 1.1 Exkurs ins menschliche Genom Die Doppelhelix ist durch mehrfaches Umwickeln sehr dicht gepackt und bildet zusammen mit HistonProteinen eine Chromatinfaser aus. Die Chromatinfaser ist ihrerseits umgewickelt und bildet Chromosomen aus. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Von Doppelhelix zu einem Chromosom

7 7 1 Einleitung 1.1 Exkurs ins menschliche Genom Bei einem Mensch gib es 23 Chromosomen, die normaler Weise doppelt vertreten sind. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Chromosomen

8 8 1 Einleitung 1.1 Exkurs ins menschliche Genom Ein Chromosom ist ca. 1,4 μm breit und ist unter dem Mikroskop sichtbar. Ein Chromosom kann mehrere Gene enthalten. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Chromosomen

9 9 1 Einleitung 1.1 Exkurs ins menschliche Genom Gen ist ein bestimmter proteinkodierender DNA Abschnitt. Im menschlichen Genom sind ca – Gene, davon sind in Mitochondrien 13 Gene. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Gen

10 10 1 Einleitung 1.1 Exkurs ins menschliche Genom Es gibt 4 verschiedene Nukleotide in der DNA: A,C,G und T Da jedes Nukleotid immer einen spezifischen Partner in dem zweiten DNA-Strang hat, nennt man die beiden Partner ein Basenpaar. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Codierung

11 11 1 Einleitung 1.1 Exkurs ins menschliche Genom Die Abfolge der Besenpaaren kann bei der Expression in die Abfolge der Aminosäuren eines Proteins übersetzt werden. Drei Basen eines DNA-Stranges sind die kleinste Informationseinheit der DNA und wird als Codon oder Basentriplett bezeichnet. Ein Codon kodiert eine bestimmte Aminosäure oder hat eine andere Funktion. Es gibt 64 (4 3 ) mögliche Codons und nur 20 Aminosäuren die sie kodieren. Das erschwert die Entzifferung der Codierung. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Codierung

12 12 1 Einleitung 1.1 Exkurs ins menschliche Genom Die Abfolge der Nukleotiden in der DNA bezeichnet man als Sequenz. Bei Menschen insgesamt: 3,2 Milliarden Besenpaaren, nur 1- 5% davon stellen Gene dar. In Mitochondrien: 16 kbp Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Sequenz

13 13 1 Einleitung 1.1 Exkurs ins menschliche Genom Man unterscheidet verschiedene Regionen der Sequenz: Exon – die proteinkodierende Region Intron – hat keine proteinkodierende Funktion. Promotor – Region, wo die Transkription startet. Terminator – Region, wo die Transkription endet. ORF – offener Leseraster. URF – nichtidentifizierter Leseraster Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Sequenz -Regionen

14 14 1 Einleitung 1.1 Exkurs ins menschliche Genom >gi| : Homo sapiens chromosome Y genomic contig GTTTGTGGCCTGGTCGGCGTCCCGTAGGGCGCCCTCCCGCGCTAGGCCGGCCGGCGTGGCG CTCGGCGCCGAACAGGCCCCGAGGAGGCCGCAGTTAGGCCTAGTGATTATCCAGTTGCCCTG AGCGGCTGCGGAGGTGCGCTCCATAAGCGGGCAGGGTGGGAAAAGTTCGCCCGTTTGTCCGG AAGGCAGTTGATGGACCTGGGGTCGACACCACTGCGGACGCAGGGCACGGCACGGGGGCGA GAAGGCGAAGGCTGCAGGCGTGAGGTGAAGGCCGGAGGCCTGCTGGGCCTATTTTCGCTATG TAAATGTCCGCGAAGGGGAGGAGGGACGGGGGGGCAAGATGGCGGCTGCTAGGCGCCTGCT GCTGGGGAGTATTGAGAGTGTTGTCGGGAGGCGGAGCCGCCATCTTGAAGGCGGTATCTGGA AAAAAAATTCGGTTATGATCCTTGAGGCGGGGATGGGGAAAAGGACGGCGGCGGCGGCGGCA GCGCAGCCTCCGGCGCGACGGCGTGTCTGCGCAACAGGGCGTGCTCGTTCCCTTGGCGGCC CTTGCCTTTGTCGCCATATGCGCGCGTACGTTCCAGACGCCTGCGGCAGCGCCACCTTTCGGC CTTCCCCTCACAGCCCATCCTTGGCTGGGTGCAGTGTCGGCTACGCTTTAGGTGACATGCCGC AGGCGTCCGTTCGGGCGCCGGGGTCATTTCGCCCCTCAGCGCTCCCGGCTCTGTGCCCTTCC GAGAGTCTACAGCCACCCGTTTCAGCAGGTGGCAATTCGGGCATCTAGGCTCACGAGAGCACA TAAATTCCAGAAAATTTTATTTTCCCCTAATTAAAGTCATTATGTGGCTGTTCGGGGACCTTCGA TGCGCTTATTTTTCAACCATC……………… Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Sequenz

15 15 1 Einleitung 1.2 Human Genom Projekt 1986 – Aufruf des amerikanischen Krebsforschers Renato Dulbecco das komplette menschliche Genom zu entschlüsseln – Amerikanische Kongress bewilligt 200 Millionen Dollar jährlich, geplant sind 15 Jahre arbeit – Start des Human Genom Projektes in Deutschland – Erste Ergebnisse würden veröffentlicht – Begann die zweite Phase des Projektes. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Daten

16 16 1 Einleitung 1.2 Human Genom Projekt Das Ziel des öffentlich finanzierten Humangenomprojektes ist, aller Wissenschaftler mit einem öffentlichem Verzeichnis der Gensequenz zu versorgen, und dadurch die biomedizinische Forschung zu beschleunigen. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Ziel

17 17 1 Einleitung 1.2 Human Genom Projekt Im Jahre1991 wird HUGO (HUman Genom Organisation) gegründet, welche die Durchführung des Projektes koordinieren soll. Wenig später hat aber eine private US-Firma "Celera Genomics" des Genforschers Craig Venter die Führung übernommen. Die deutschen Firmen erhoffen bei der zweiten Phase des Projektes, wo es hauptsächlich um die Erkennung der Genfunktionen geht, die Nase vorne zu halten. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Firmen

18 18 1 Einleitung 1.2 Human Genom Projekt Obwohl in der Presse schon mehrmals verkündet wurde, dass das menschliche Genom beinah vollständig entziffert ist und veröffentlicht wurde, Wissenschaftler in der ganzen Welt arbeiten noch heftig daran. Hauptgrunde dafür sind: Die Funktion der meisten Genen ist noch unbekannt. Viele Gene besitzen mehrere Funktionen. Die entzifferten Gensequenz kann Fehler enthalten. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Ergebnisse

19 19 2 Ziele und Probleme beim graphischen Darstellen von Genomen 2.1 Ziele Wie in Humangenomprojekt ist auch hier das Hauptziel, aller Wissenschaftler mit der öffentlichen Gensequenz zu versorgen. Die entzifferten Daten sind da, aber die sind oft viel zu unübersichtig und komplex, deshalb werden effektive Visualisierungswerkzeuge gebraucht, welche die Wissenschaftler helfen damit zu arbeiten. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Die Bereitstellung der Sequenz

20 20 2 Ziele und Probleme beim graphischen Darstellen von Genomen 2.1 Probleme Ein nützlicher und effektiver Weg etwas unübersichtliches sichtbar zu machen ist die grafische Darstellung. Providerswerkzeuge: Das LocusLink von NCBI und der Genomsuch-Browser von UCSC. Beide arbeiten aber in sogenannten Client-server model Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Grafische Darstellung

21 21 2 Ziele und Probleme beim graphischen Darstellen von Genomen 2.1 Probleme Das Client-server model erschwert viele Manipulationen. Es wird versucht das Problem durch Java-Applets zu lösen, die von dem Server runtergeladen werden können und in einer Java vitrual machine auf dem PC des Benutzers laufen und verändern werden können. Aus Sicherheitsgründen sind die Java-Applets aber etwas problematisch, da die sehr wohl Trojaner seien können. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Java-Applets

22 22 3 ProtAnnot und Neomorphic GeneViewer 3.1 Hintergrund Als Beispiele der alternativen Visualisierungstechnik werden hier als erstes ein Prototyp des Protein-Domain-Viewer ProtAnnot und Neomorphic GeneViewer, ein Genombrowser, der zuerst für das Institut der Genomforschung (TIGR) speziell für das Arabidopsis Genom geschrieben wurde. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung ProtAnnot und Neomorphic GeneViewer

23 23 3 ProtAnnot und Neomorphic GeneViewer 3.2 Semantisches Zooming Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Semantisches Zooming

24 24 3 ProtAnnot und Neomorphic GeneViewer 3.3 Zweidimensionales Zooming Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Zweidimensionales Zooming

25 25 3 ProtAnnot und Neomorphic GeneViewer 3.4 Einzelne oder doppelte Reihenfolge der Genstruktur Gen-Finder-Programme. Sequenzen werden in zwei parallelen Reihen dargestellt und so verglichen. Ca. 1/2 - 1/3 der menschlichen Genen enthalten mehrere Transkriptionsvarianten. Erkennung oft nur von einer Transkriptionsvariante. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Doppelte Reihenfolge der Genstruktur

26 26 3 ProtAnnot und Neomorphic GeneViewer 3.4 Einzelne oder doppelte Reihenfolge der Genstruktur Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Einzelne Reihenfolge der Genstruktur

27 27 3 ProtAnnot und Neomorphic GeneViewer 3.5 Umgang mit der Komplexität der Informationen ESTs (expressed sequence tags) von SNURF-Gen, das in der Lage ist zwei unterschiedliche Proteine zu kodieren. RT-PCR Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Umgang mit der Komplexität der Informationen

28 28

29 29 3 ProtAnnot und Neomorphic GeneViewer 3.6 Proteinvorhersage ARG1 (Arginase – Gen) Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Das alternative Splicing (oder Spleissen)

30 30 3 ProtAnnot und Neomorphic GeneViewer 3.6 Proteinvorhersage Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Zwei Formen eines plasminogen Aktivators

31 31 -alle gefundenen Geninformationen werden in Text basierenden Datenbanken gespeichert -kein intuitives Verständnis über die komplexe Struktur von Genen möglich -Datenbanken liefern graphische Darstellungen nur zu einer Fragestellung -SeqVISTA übernimmt die Aufgabe der graphischen Visualisierung von verschiedenen Datenbankinformationen gleichzeitig Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Hintergrund 4 4.1

32 32 einfaches Verständnis durch dreigeteilten Bildschirm (tree panel, graphics panel und sequence panel) Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung SeqVISTA 4 4.2

33 33 Suchfunktionen innerhalb der Sequenz -Start- und Endsequenz sind bekannt -Sequenzfragment ist bekannt -durch Markierung einer Region in der Sequenz Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung SeqVISTA 4 4.2

34 34 Vorteile von SeqVISTA im Bezug auf Datenimport -Akzeptanz der wichtigsten Datenbankformate (GenBank flat file format [GBFF], GenBank HTML format, FASTA format und meta-based SeqVISTA format.) -einfaches Laden der Sequenz durch Eingabe der GI oder durch Laden von der NCBI-Internetseite. -durch Pluginentwicklung können externe Analyseprogramme SeqVISTA zur graphischen Visualisierung nutzen. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung SeqVISTA 4 4.2

35 35 Untersuchung der Lage und Eigenschaften repetitiver Elemente im Bezug zur Gesamtsequenz. Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung repetitive Elemente 4 4.3

36 36 PSIPRED berechnet wahrscheinliche sekundär Strukturen der Proteine anhand der Gensequenz Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Proteinstruktur 4 4.4

37 37 -komplexe Gensequenzen werden übersichtlich dargestellt -Zugriff auf externe Programme zu vertiefenden Analysen -Darstellung externer Ergebnisse Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung Zusammenfassung 5


Herunterladen ppt "1 GDV Proseminar Visualisierung in der Bioinformatik Genom – Visualisierung FfM., den 05.06.2003 Oleg Rempel und Sven Zöller Johann Wolfgang Goethe-Universität."

Ähnliche Präsentationen


Google-Anzeigen