Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Proteinbiosynthese e-book von S.Heim Demo-Version.

Ähnliche Präsentationen


Präsentation zum Thema: "Proteinbiosynthese e-book von S.Heim Demo-Version."—  Präsentation transkript:

1 Proteinbiosynthese e-book von S.Heim Demo-Version

2 Inhalte Vom Gen zum Phän Proteinbiosynthese –Transkription –Translation –Codesonne/ Codetabelle m-RNA Übungen Bild- & Textquellen

3 Vom Gen zum Phän Um ein bestimmtes Merkmal (Phän) ausbilden zu können muss mindestens ein spezifischer Stoff hergestellt werden, also ein bestimmter Stoffwechselschritt vollzogen werden. Um solche Stoffwechselprozesse (Aufbau, Umbau, Abbau etc.) durchführen zu können, müssen entsprechende Biokatalysatoren, also Enzyme, vorhanden sein. Die Enzyme gehören zur Stoffgruppe der Proteine/ Eiweiße. In den Genen/ der Erbsubstanz DNA stehen also die Bauanleitungen der für eine bestimmte Produktion nötigen Enzyme. Ein Gen entspricht also einer Enzymbauanleitung, man spricht auch von der Ein-Gen-ein-Enzym-Hypothese. Zu den Inhalten

4 Proteinbiosynthese: Transkription 1.An einer Erkennungssequenz erkennt die RNA-Polymerase den Beginn eines Gens und entspiralisiert die DNA und öffnet die Wasserstoffbrücken. 2.Am codogenen Strang lagern sich in 3 5 – Richtung RNA-Nukleotide komplementär an. Diese Nukleotide besitzen alle den Zucker Ribose statt Desoxyribose. Außerdem ist jetzt die Base Uracil komplementär zu Adenin. 3.Die durch H-Brücken gehaltenen angedockten Nukleotide werden zum m-RNA-Strang zusammengeklebt. Das Ende eines Gens besitzt eine Terminationssequenz. 4.Die einsträngige, fertige m-RNA löst sich ab und wandert durch die Kernporen ins Cytoplasma zu den Ribosomen. Gleichzeitig verlässt das Enzym Polymerase die DNA, die sich wieder zusammenlagert und spiralisiert. Zu den Inhalten

5 Proteinbiosynthese: Translation 1.Das Ribosom setzt sich aus seinen 2 Untereinheiten so um das 5-Ende der m-RNA zusammen, dass sich das 1.Codon im Eingangsbereich befindet. 2.Für das Codon im Eingangsbereich wird eine beladene t-RNA mit passendem Anti-Codon gesucht, die dann am Codon andockt. 3.Das Ribosom verrutscht um 1 Codon in Richtung des 3-Endes. Dadurch be- findet sich das Codon samt angehängter t-RNA jetzt im Ausgangsbereich und für den Eingangsbereich, in dem sich jetzt das nächste Codon befindet wird wieder eine passende t-RNA angedockt. (s.Abb.) 4.Jetzt verknüpft ein Enzym die beiden Aminosäuren (AS) miteinander. (2) Anschließend trennt ein Enzym die AS im Ausgangsbereich von der t-RNA ab. Die entladene t-RNA löst sich und wandert ins Cytoplasma, wo sie neu beladen wird. Das Ribosom verrutscht erneut um ein Codon. 5.Die Vorgänge 2-4 werden so lang wiederholt, bis das letzte Codon (Stopp-Codon) im Aus- gangsbereich liegt. Jetzt trennt das Enzym die fertige AS-Kette ab und das Ribosom zer- fällt in seine 2 Einheiten. Zu den Inhalten

6 Code-Sonne & -Tabelle Wie liest man ein m-RNA-Codon ab? Codon: 5 …AGU …3 A G U Ser = Serin Von Innen nach Außen: Schnittpunkt von Feld (A), Spalte (G) und Zeile (U) Zu den Inhalten

7 Übungen Übung 1 Übung 2 Übung 3 Übung 4 Übung 5 Zu den Inhalten

8 Übung (1) Wie lautet der Abschnitt des codogenen Strangs? 5´…CAGUUAUCGAAACGCAGUCAGUUAAACUAA… 3´ Wie lautet die AS-Sequenz? m-RNA Lösung Übungsübersicht

9 Übung (2) Welche Folgen hat eine Deletion in Position 7 der DNA? 5´…CAGUUAUCGAAACGCAGUCAGUUAAACUAA… 3´ Wie lautet die neue AS-Sequenz? m-RNA Lösung Übungsübersicht

10 Übung (3) Dies ist ein Abschnitt des nicht-codogenen Strangs: 5´ … T C A G T A A C T C C A A G G G A T T A G …3´ Wie lautet der m-RNA Abschnitt? Wie lautet die AS-Sequenz? m-RNA Lösung Übungsübersicht

11 Übung (4) Die AS-Sequenz: … Met – Val – Ala – Pro – Asp … wurde in einem Eiweiß gefunden. Nach welchen möglichen Basenfolgen muss im codogenen Strang gesucht werden? m-RNA Lösung Übungsübersicht

12 Übung (5) Dies ist ein Abschnitt des codogenen Strangs: 5´ … T C A G T A A C T C C A A G G G A T T A G …3´ Wie lautet der m-RNA Abschnitt? Wie lautet die AS-Sequenz? m-RNA Lösung Übungsübersicht

13 Bild- & Textquellen Genetik. Schroedel (Grüne Reihe) Themenband. Braunschweig (Code- Tabelle) Natura – Oberstufenband. Klett Verlag, Stuttgart (Code-Sonne) für das kommende gif-Bildwww.rippenschneider.de Übungsübersicht Zu den Inhalten

14

15 Lösung (1) 3´… GTCAATAGCTTTGCGTCAGTCAATTTGATT…5´ 5´…CAGUUAUCGAAACGCAGUCAGUUAAACUAA… 3´ Gln – Leu – Ser – Lys – Arg – Ser – Gln – Leu – Asn - Stopp m-RNA Übungsübersicht

16 Lösung (2) 3´… GTCAATAGCTTTGCGTCAGTCAATTTGATT…5´ 5´…CAGUUAUCGAAACGCAGUCAGUUAAACUAA… 3´ Gln – Leu – Arg – Asn – Ala – Val – Thr - Stopp m-RNA Deletion Es kommt zur Leserastermutation, dem frameshift. Ab der Deletionsposition werden neue Codons gelesen und andere AS eingebaut. Hierbei entsteht ein vorzeitiger Kettenabbruch. Dies hat in aller Regel gravierende bis letale Folgen! Übungsübersicht

17 Lösung (3) Dies ist ein Abschnitt des nicht-codogenen Strangs: 5´ … T C A G T A A C T C C A A G G G A T T A G …3´ 5´ …U C A G U A A C U C C A A G G G A U U A G…3´ AS: … Ser – Val – Thr – Pro – Arg – Asp – Stopp … m-RNA Übungsübersicht

18 Lösung (4) MetValAlaProAsp Codon AUGGUUGCUCCUGAU GUCGCCCCCGAC GUAGCACCA GUGGCGCCG DNATACCAACGAGGACTA CAGCGGGGGCTG CATCGTGGT CACCGCGGC Jede Kombination ist möglich! Übungsübersicht

19 Lösung (5) Dies ist ein Abschnitt des codogenen Strangs: 5´ … T C A G T A A C T C C A A G G G A T T A G …3´ 3´ …A G U C A U U G A G G U U C C C U A A U C…5´ AS: …Stopp – Tyr – Ser – Trp - Pro - Ile – Leu … (Reihenfolge der AS von rechts nach links!) m-RNA Übungsübersicht


Herunterladen ppt "Proteinbiosynthese e-book von S.Heim Demo-Version."

Ähnliche Präsentationen


Google-Anzeigen