Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

© W. Puppe Multiplex-RT-PCR-ELISA. Copyright & Rechtliche Hinweise Das Copyright für diese Präsentation und einzelner Folien dieser Präsentation bleibt.

Ähnliche Präsentationen


Präsentation zum Thema: "© W. Puppe Multiplex-RT-PCR-ELISA. Copyright & Rechtliche Hinweise Das Copyright für diese Präsentation und einzelner Folien dieser Präsentation bleibt."—  Präsentation transkript:

1 © W. Puppe Multiplex-RT-PCR-ELISA

2 Copyright & Rechtliche Hinweise Das Copyright für diese Präsentation und einzelner Folien dieser Präsentation bleibt allein beim Verfasser. Eine Vervielfältigung oder Verwendung dieser Präsentation sowie der darin enthaltenen Grafiken, und Texte in anderen elektronischen oder gedruckten Publikationen ist ohne ausdrückliche schriftliche Genehmigung des Verfassers dieser Präsentation nicht gestattet. Der Benutzer dieser Präsentation erkennt an, dass deren Gebrauch ausschließlich auf dessen eigene Gefahr erfolgt und dass weder der Verfasser der Präsentation noch eine andere Partei, die an der Erstellung beteiligt war, eine Haftung für direkte, indirekte oder Folgeschäden jeglicher Art übernimmt. © W. Puppe Universitätsklinikum Schleswig Holstein, Campus Kiel, Klinik für Allgemeine Pädiatrie, Schwanenweg 20, KIEL Um auf die nächste Folie zu gelangen betätigen Sie die Maus. Damit bestätigen Sie gleichzeitig die obigen Hinweise zu akzeptieren. Die Steuerung der Präsentation ist über die Maustasten möglich. Zur optimalen Darstellung wählen Sie über die rechte Maustaste die Option Full Screen aus. © W. Puppe

3 UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel Mikrobiologische Labor der Kinderklinik Nachweis von Erregern bei Akuten Infektionen des Respirationstraktes © W. Puppe

4 Nachweis von Erregern mit RT-PCR RT-PCR - Nachweis viraler RNA durch reverse Transkription mit anschließender Polymerase Chain Reaction © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

5 Zielsequenz (RNA) Primer Reverse Transkriptase d-ATP d-CTP d-GTP d-TTP RT-PCR - reverse Transkription der RNA in der Probe Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

6 RT-PCR - reverse Transkription der RNA in der Probe Primer d-ATP d-CTP d-GTP d-TTP ACGGTCTTG Zielsequenz (RNA) Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

7 Primer d-ATP d-CTP d-GTP d-TTP ACGGTCTTGCAATGCGTGTACCGTACGGTGTTGTA Zielsequenz (RNA) RT-PCR - reverse Transkription der RNA in der Probe Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

8 Primer ACGGTCTTGCAATGCGTGTACCGTACGGTGTTGTACACGTAGACGATGGACCATGTGACGTAAGGT ERGEBNIS c-DNA RT-PCR - reverse Transkription der RNA in der Probe Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

9 RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction 1 Kopie c-DNA Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

10 c-DNA denaturieren bei 94°C RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

11 RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction c-DNA denaturieren bei 94°C Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

12 annealen von spezifischen Amplifikations-Primern an Einzel-Strang 50°C Primer 1 Primer RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

13 Transkription durch Taq-Polymerase 72°C Taq-Polymerase d-ATP;d-CTP; d-GTP; d-TTP Primer CA RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

14 Taq-Polymerase d-ATP;d-CTP; d-GTP; d-TTP Primer CTGCTACCTGGTACACTGCATTCCA Transkription durch Taq-Polymerase 72°C RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

15 Taq-Polymerase d-ATP;d-CTP; d-GTP; d-TTP Primer TGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA Transkription durch Taq-Polymerase 72°C 1. Zyklus 1 Kopie RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

16 Denaturieren 94°C 2. Zyklus 3 5 TGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

17 Denaturieren 94°C 2. Zyklus 3 5 TGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

18 annealing der Primer 50°C 2. Zyklus Primer 2 35 d-ATP; d-CTP; d-GTP; d-TTP RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Primer 1 Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

19 Transkription mit Taq-Polymerase 72°C 2ter Zyklus CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Primer 2 35 Primer 1 TGGTACACTGCATTCCA ACGGTCTTGCAA RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

20 Transkription mit Taq-Polymerase 72°C 2ter Zyklus Primer 2 35 ACGGTCTTGCAATGCGTGTACCGTAC ACGTAG RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Primer 1 CATG TGCATCTGCTACCTGGTACACTGCATTCCA Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

21 Transkription mit Taq-Polymerase 72°C 2ter Zyklus Primer 2 35 RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Primer 1 CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA ACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

22 nach dem 2ten Zyklus 2 Kopien GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA 35 CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

23 3ter Zyklus 94°C GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

24 3ter Zyklus 50°C GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Primer 2 Primer 1 Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

25 3ter Zyklus 72°C GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Primer 2 ACACTGCATTCCA Primer 2 ACACTGCATTCCA Primer 1 ACGGTCTTGCAAT Primer 1 ACGGTCTTGCAAT Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

26 3ter Zyklus 72°C GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Primer 2 ACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA Primer 2 ACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA Primer 1 ACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGAT Primer 1 ACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGAT Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

27 4 Kopien nach 3tem Zyklus 72°C GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Primer 2 CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA Primer 2 CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCA Primer 1 ACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA Primer 1 ACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

28 nach dem 4ten Zyklus 8 Kopien CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

29 nach dem 5ten Zyklus 16 Kopien RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

30 in der Praxis erhält man nach 21 bis 31 Zyklen 10 6 bis 10 9 Kopien eines Fragmentes welches auf der Zielsequenz mit einem hoch spezifischen Primer Paar amplifiziert wurde RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

31 Multiplex-RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction Nachweis von Erregern mit multiplex-RT-PCR Verwendung von Primer Paaren die spezifisch für hoch konservierte Zielsequenzen der 19 Erreger sind in einem RT-PCR-Ansatz © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

32 Ergebnis einer m-RT-PCR m-RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction - Analyse der amplifizierten Fragmente im Agarosegel % Agarose bp 3. entero virus (154) 4. M. pneumoniae (277) 5. Inf A (190) 6. Inf B (249) 1. standard 2. negative controle 7. adenovirus (134) 8. C. pneumoniae (463) 9. PIV1 (179) 10. PIV3 (205) 11. RSV (239) 12. B. pertussis 13. B. parapertussis Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

33 m-RT-PCR - reverse Transkription der RNA in der Probe - anschließende Amplifikation mit Polymerase Chain Reaction - Analyse der amplifizierten Fragmente im Agarosegel - Spezifizierung der Amplifikate im PCR-ELISA Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

34 GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Primer 2 Primer 1 Primer 2 GCATG TGCATCTGCTACCTGGTACACTGCATTCCA ACGGUCTTGCAATGCGTGUACCGTAC ACGTAG d-UTP Transkription mit Taq-Polymerase 72°C RT-PCR-ELISA - Einbau von DIG-11-dUTP ( ) in die Amplifikate bei der PCR GAGAGACGGTCTTGCAATGCGTGTACCGTAC ACGTAGACGATGGACCATGTGACGTAAGGTAATTA CTCTCTGGCAGAACGTTACGCACATGGCATG TGCATCTGCTACCTGGTACACTGCATTCCATTAAT Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel d-UTP

35 RT-PCR-ELISA - DIG-11-dUTP markierte Fragmente aus der PCR - alkalische Denaturierung Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

36 GATAGTAACTCACUGTTTGTTAACATGTAAGTGCTTAAAGGTGTUGTTACA CCTGCATTGACACTGAATTC TCTGGTGATTTCCAACAATCTGCUGTTCTTCTGCTGGAATUCTATAACTGTTT GGACGTAACTGTGACTTAAG RT-PCR-ELISA - DIG-11-dUTP markierte Fragmente aus der PCR - alkalische Denaturierung - Hybridisierung mit spezifischer Sonde (Biotin markiert ) Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

37 GATAGTAACTCACUGTTTGTTAACATGTAAGTGCTTAAAGGTGTUGTTACA CCTGCATTGACACTGAATTC TCTGGTGATTTCCAACAATCTGCUGTTCTTCTGCTGGAATUCTATAACTGTTT GGACGTAACTGTGACTTAAG RT-PCR-ELISA - DIG-11-dUTP markierte Fragmente aus der PCR - alkalische Denaturierung - Hybridisierung mit spezifischer Sonde (Biotin markiert) - Bindung an Strepavidin beschichtete Mikrotiterplatte Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

38 GATAGTAACTCACUGTTTGTTAACATGTAAGTGCTTAAAGGTGTUGTTACA CCTGCATTGACACTGAATTC TCTGGTGATTTCCAACAATCTGCUGTTCTTCTGCTGGAATUCTATAACTGTTT GGACGTAACTGTGACTTAAG RT-PCR-ELISA - DIG-11-dUTP markierte Fragmente aus der PCR - alkalische Denaturierung - Hybridisierung mit spezifischer Sonde (Biotin markiert) - Bindung an Strepavidin beschichtete Mikrotiterplatte - Antikörper gegen DIG (Konjugat mit Enzym ) Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

39 GATAGTAACTCACUGTTTGTTAACATGTAAGTGCTTAAAGGTGTUGTTACA CCTGCATTGACACTGAATTC TCTGGTGATTTCCAACAATCTGCUGTTCTTCTGCTGGAATUCTATAACTGTTT GGACGTAACTGTGACTTAAG RT-PCR-ELISA - DIG-11-dUTP markierte Fragmente aus der PCR - alkalische Denaturierung - Hybridisierung mit spezifischer Sonde (Biotin markiert) - Bindung an Strepavidin beschichtete Mikrotiterplatte - Antikörper gegen DIG (Konjugat mit Enzym ) - Zugabe von Substrat Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

40 GATAGTAACTCACUGTTTGTTAACATGTAAGTGCTTAAAGGTGTUGTTACA CCTGCATTGACACTGAATTC TCTGGTGATTTCCAACAATCTGCUGTTCTTCTGCTGGAATUCTATAACTGTTT GGACGTAACTGTGACTTAAG RT-PCR-ELISA - DIG-11-dUTP markierte Fragmente aus der PCR - alkalische Denaturierung - Hybridisierung mit spezifischer Sonde (Biotin markiert) - Bindung an Strepavidin beschichtete Mikrotiterplatte - Antikörper gegen DIG (Konjugat mit Enzym ) - Zugabe von Substrat Farbentwicklung Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

41 RSV Sonde Ev-Sonde Mp-Sonde InfA-Sonde InfB-Sonde Ad-Sonde Cpn-Sonde PIV3-Sonde PIV1-Sonde RSV Sonde Enterovirus M. pneumoniae Influenza A Influenza B Adenovirus C. pneumoniae PIV1 PIV3 RSV neg. Präparation Kontrollen RT-PCR-ELISA - Ergebnis eines m-RT-PCR -ELISA (Mikrotiterplatte) Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

42 RSV Sonde Ev-Sonde Mp-Sonde InfA-Sonde InfB-Sonde Ad-Sonde Cpn-Sonde PIV3-Sonde PIV1-Sonde RSV Sonde Enterovirus M. pneumoniae Influenza A Influenza B Adenovirus C. pneumoniae PIV1 PIV3 RSV neg. Präparation Kontrollen 2% Agarose bp PIV1 (179) PIV3 (205) RSV (239) Cpn (463) Av (134) InfB (249) InfA (190) Mpn (277) Ev (154) RT-PCR-ELISA - Ergebnis eines m-RT-PCR -ELISA (Mikrotiterplatte & Gel) Nachweis von Erregern mit multiplex-RT-PCR © W. Puppe UK-SH / Campus Kiel Allgemeine Pädiatrie Pädiatrische Infektiologie Christian Albrechts Universität zu Kiel

43 © W. Puppe Multiplex-RT-PCR-ELISA

44 © W. Puppe Multiplex-RT-PCR-ELISA

45 © W. Puppe Multiplex-RT-PCR-ELISA

46 © W. Puppe Multiplex-RT-PCR-ELISA


Herunterladen ppt "© W. Puppe Multiplex-RT-PCR-ELISA. Copyright & Rechtliche Hinweise Das Copyright für diese Präsentation und einzelner Folien dieser Präsentation bleibt."

Ähnliche Präsentationen


Google-Anzeigen