Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest 

Ähnliche Präsentationen


Präsentation zum Thema: "Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest "—  Präsentation transkript:

1 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest 

2 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Begriffe Putativvater: möglicher Vater Dublette: Mutter und eigenes Kind Terzett: Dublette und Putativvater Defizienzfall: Gestestet werden nur Putativvater und Kind 

3 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Entwicklung von Methoden zur Klärung von Vaterschaftsfragen 

4 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest 1937: E SSEN -M ÖLLER -Methode Vergleich von sichtbaren Merkmalen, z.B. Haarfarbe x: W‘keit, dass Ausprägung bei Kind und Putativvater gleich sind y: W‘keit, dass Ausprägung bei Kind und beliebigem Mann gleich sind Bsp: x = 17%, y = 3% p(V + ) = x / (x + y) = 85% p(V + ) = (1-x) / ((1-x) + (1-y)) = 46,1% Auch unter Berücksichtigung vieler Merkmale: schwammig, ungenau und statistisch falsch 

5 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest 1950: Blutgruppen Test der Blutgruppenmerkmale (A 1 A 2 B0), (MN,Ss), (Pp), „Rh“ (CcC W, Dd, Ee), (Lu a Lu b ), (Le a Le b ), (Kk) Alleine wenn die Übereinstimmung von (A 1 A 2 B0) und die Geschmacksblindheit gegen Phenylthiocarbamid nicht übereinstimmt, kann eine Vaterschaft zu 99,8% ausgeschlossen werden (Unsicherheiten bei der Testdurchführung) Vorgeschlagen wurden 96% als ausreichend für eine Beurteilung  Genotypen  Phänotypen 

6 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Phänotypkonstellationen im AB0-System Phänotyp der ElternMögliche Phänotypen der Kinder Ausschluss- konstellationen 0 x 0 0 x A 0 x B 0 x AB A x A A x B A x AB B x B B x AB AB x AB 0 0, A 0, B A, B 0, A 0, A, B, AB A, B, AB 0, B A, B, AB B, AB A, AB 0, AB B, AB - 0 A, AB 0 Vorsicht: Fehler in der Laboruntersuchung möglich, z.B. Probenvertauschen 

7 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Analyse anderer Proteingruppen Neben Blutgruppen wurden wegen ihrer hohen Variabilität auch benutzt: Serumproteingruppen (Ig, C3, Transferrin,…) Erythrozytenenzyme (Glutamat-Pyruvat-Transaminase, …) HLA-System (MHC, Bestimmung des Haplotyps) 

8 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Heute benutzte Methoden Fallbeispiel 50-jähriger Mann gibt ein Vaterschaftsgutachten in Form eines reinen STR-Gutachtens in Auftrag. Er stellte sich die Frage, ob der jetzt 78-jährige Ehemann seiner Mutter tatsächlich sein leiblicher Vater ist oder nicht. Die Mutter willigte zunächst nicht in eine Untersuchung ein, so dass lediglich Kind und Putativvater in die Analyse einbezogen werden konnten (Defizienzfall). Rechtsmedizin 2003 · 13 : , von Wurmb-Schwark et al. 

9 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest STR-Analyse Ablauf der Analyse: Amplifizierung mit Multiplex - PCR bestimmter STRs der DNA-Probe STR = Short Tandem Repeat (Polymorphism) z.B. TACTACTACTACTAC GTGCTGAACCAGCTACTACTACTACTATCAGCTACTACTACTACTATCAGCTACTACTACTACTATCAGCTACTACTACTACTATC 

10 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest STR-Analyse Ablauf der Analyse: Auftrennung mit Kapillarelektrophorese/PAGE C GT A C A TC GT A C A TT A CC GT A C T CT A C A TT A C Allel Nomenklatur: Name des Genortes (z.B. FAG) und Anzahl der Wiederholungen. Bei unvollständigen Repeats: Anzahl vollständiger Repeats und Anzahl einzelner Nukleotide. Beispiel (2 Chromosomen): FAG 12 / 7.2 

11 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Typisierungsmuster von Kind und Putativvater GenortKindPutativvaterAusschlüsse D8S1179 D21S11 D7S820 CSF1PO D3S1358 TH01 D13S317 D16S539 D2S1338 D19S433 VWA TPOX D18S51 D5S818 FGA SE33 13/14 28/30 10/13 10/11 15/18 6/8 8/ / /17 9/11 14/15 11/12 21/22 14/ /30 9/10 10/11 14/ /12 24/25 14/ /18 8/11 14/17 12/13 24/ /24.2 AAAA 

12 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Ergebnis STR-Analyse 2 unterschiedliche Genorte (TH01, FGA) Wahrscheinlichkeit, dass Putativvater der wahre Vater ist: 99,751406% Richtlinien fordern aber mindestens 99,9% Andererseits werden für einen Ausschluss mindestens 3 Unterschiede auf verschiedenen Chromosomen gefordert Vermutung: Putativvater könnte naher Verwandter des wahren Vaters sein 

13 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest RFLP RFLP: Restriktionsfragmentlängenpolymorphismus Zerschneiden der DNA mit Restriktionsenzymen Markierung von bestimmten DNA-Stücken mit Sonden (radioaktiv oder fluoreszierend) Auftrennung mit Elektrophorese Sichtbarmachen der Banden SondeKindPutativvaterAusschluss MS1 MS31 MS43A G3 YNH24 MS205 7,48/3,94 6,85/6,68 8,58/5,19 7,16/3,23 3,36/2,62 2,73/2,46 8,57/2,17 6,68/3,00 9,16/7,62 10,23/3,02 3,02/- 2,90/2,01 AAAAAAAAAA Ergebnis der Single-Locus-Analyse, Größe der detektierten Banden in Kilobasen 

14 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Ergebnis RFLP-Analyse Lediglich bei einer von sechs Sonden zeigt sich Übereinstimmung  Putativvater ist mit großer Sicherheit nicht mit dem Kind verwandt 

15 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest STR-Analyse des Tripletts GenortKindPutativvaterDefizienzfallTriplettMutter D8S1179 D21S11 D7S820 CSF1PO D3S1358 TH01 D13S317 D16S539 D2S1338 D19S433 VWA TPOX D18S51 D5S818 FGA SE33 13/14 28/30 10/13 10/11 15/18 6/8 8/ / /17 9/11 14/15 11/12 21/22 14/ /30 9/10 10/11 14/ /12 24/25 14/ /18 8/11 14/17 12/13 24/ /24.2 AAAA AAAAAAAAAAAAAA 13 30/32 8/13 10/13 14/18 6/9 8/12 11/12 24/25 13/14 16/ /14 11/12 18/21 14/18 Einbeziehung der mütterlichen Merkmale führt zu 7 Ausschlüssen. 

16 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Ergebnis Ausschlusswahrscheinlichkeit des Putativvaters: 99,9999% Problematik: Wird in einem Defizienzfall nur ein Test durchgeführt, kann es zu falschen Ergebnissen kommen (Leitlinien fordern zwei). Sicherer ist ein Komplettgutachten (Kombination beider Methoden, STR und RFLP), am Besten am Triplett. 

17 Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest Wahrscheinlichkeiten GenortTatortVerdächtiger TH01 VWA 6/8 16 6/8 16 In der Bevölkerungsgruppe findet man folgende Häufigkeiten der Allele: TH01 6: 17% TH01 8: 5% VWA 16: 12% Wahrscheinlichkeit für das Vorkommen der Kombination am Tatort: P = 17% · 5% · 2 · 12% = 0,204%  Bei Personen kommt diese Kombination durchschnittlich bei 20,4 Personen vor  Die W’keit, dass der Verdächtige nicht der Täter ist liegt bei 0,204%, also ist er mit 99,706%er W’keit der Täter Hinzunahme von weiteren STRs ergibt noch sicherere Resultate. Bei Abstammungsgutachten werden außerdem die Mutationsraten der einzelnen Genorte benutzt. 


Herunterladen ppt "Genetischer Fingerabdruck, STR-Analyse beim Vaterschaftstest "

Ähnliche Präsentationen


Google-Anzeigen