Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-1 Interessierende Objekte in der Bioinformatik: Molekularbiologische.

Ähnliche Präsentationen


Präsentation zum Thema: "Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-1 Interessierende Objekte in der Bioinformatik: Molekularbiologische."—  Präsentation transkript:

1 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-1 Interessierende Objekte in der Bioinformatik: Molekularbiologische Grundlagen

2 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-2 Ein kleiner Exkurs in die Molekularbiologie: Vom Gen zum Phän DNA Transkription: Ergebnis ist Boten-RNA Translation: Ergebnis ist Aminosäuresequenz Protein in Primärstruktur Pflanze (Organismus) Faltung Sekundär-und Tertiär-Struktur

3 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-3 Ein kleiner Exkurs in die Molekularbiologie: Vom Gen zum Phän ATGACGT GCCGTACGGTTG CAGTACGTATCA CGTACATGACATC CGGAATCTTACAA GTACATAAACAG TCTACAAGCTCC GGATCAA Pflanze (Organismus) ADQLTEE QIAEFLFDKD KEAFSLFDLFDKDKD GDGTILFDKDTTLFD DTVMRSLGLFDKDQ NPTLFDKDEAELQD NLFDLFDKDKDEL KDDLFDKDL DNA: Protein:

4 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-4 Ein kleiner Exkurs in die Molekularbiologie: Der Genetische Code Jeweils 3 zusammenhängende Nukleotide codieren eine Aminosäure! 4³ = 64 aber nur 20 Aminosäuren in Organismus!

5 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-5 Ein kleiner Exkurs in die Molekularbiologie: Translation

6 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-6 Ein kleiner Exkurs in die Molekularbiologie: Ein kleiner Exkurs in die Molekularbiologie: Von der DNA bis zum Stoffwechselweg

7 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-7

8 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-8 GGTCCTCCTCTCGGCCTGCTTTATCCTGCCTCCCCCTTCTCCTCTCCACCTGCTAGATCTAGAGTAGCTCCTAAGCCCACGAAAACCC CGCCGCGAGATCTGCGCATCTCGCAACACCACCACCATGGCGGCGCCGCGCGTCCTCCTCCTCCTCGCCGCCGCGGCCCTCCTCTCCG TCTCCTCCCTCGGAGACGCTTCGGGCGATGGCCCCCGCGGGCGCAAGCTGCTGGTGCTCGTCGACGATCTGGCCGTCCGCTCCTCCCA CTCGGCCTTCTTCGGCTCGCTCCAGGCCCGCGGGCTAGATCTGGAGTTCCGCCTCGCGGACGACCCCAAGCTCTCGCTCCACCGCTAC GGTCAGTACCTCTACGACGGCCTCGTCCTCTTCGCCCCGTCGACCCCGCGCTTTGGCGGATCGGTGGACCAGAACGCTGTTCTGGAGT TCATCGATGCTGGGCACGACATGATTCTGGCAGCAGATCATTCGGCTTCTGATCTGATCCGCGGCATCGCAACCGAGTGTGGGGTTGA TTTTGATGAGGACCCGGAAGCGATGGGTTATTGACCACATTAATTATGCCTCCAACTGGAGTCTGAAGGGGGGATCACAACCTTTTAC TGCGGAAAGNACAAGGATGAGCTCATCAAGAACGCTGCCTACATTGNCACCCCTGGAAAGGGTATTCTTGCTGCTGACGAGTCCGCTA CTGTCACTGACAGCCTCAGGTCACTCGAAGCAAGGTTAGCTAGCTAGCACGCAGTGAGCGATGGCGGNCGCGGCGACCATGGCGCTCT CCTCCCCGGCGATGGCCGGCACCCCGGTGAAGGCCTCCAGGGCGGCGCCCTTCGGCGAGGGCCGCATCACCATGCGCAAGACGGCGGG CAAGCCCAAGGTGGCGGCGTCCAGCANCCCGTGGTACGGCTCCGACCGCGTGCTCTACCTCGGCCCGCTCTNCGGCGACCCCCCGAGC TACCTCACCGGCGAGTTCCCCGGCGACTACGGCTGGGACACCGCGGGGCTGTCCGCCGACCCCGAGACCTTCNCCAAGAACCGTGAGC TGGAGGTCATCCACTGCCGCTGGGCCATGCTCGGCGCGCTCGGCTGCGTCTTCCCCGAGCTGCTCGCCCGCAACGGCGTCAAGTTCGG CGAGGCCGTGTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTCGGCAACCCCAGCCTCGTCCACGCCCAG AGCATCCTCGCCATCTGGGCCTGCCAGGTGGTGCTCATGGGCGCCGTCCGAGGGCTACCGCGTCGCCGGCGGCCCGCTCGGCGAAGAT CGTCGACCCGGCTCTACCCCGGCGGCAAGCTTCGACCCCCTGGGCCTCGCCCGAGGGACCCCGAGGCCTTCGGGGGTGACCATCCTGG CGCCCGTCAAGTCGCCCAACACGGACGGCATCAGTCGTCTCCGGCGACGACTGCGTGGCCATCAAGAGCGGCTGGGACGAGTACGGNA TCNCCGTCGGCATGCCCAGCGAGCACATCTCGGTGCGCCGCCTCACCTGCGTGTCCCCGACCAGCGCGGTGATCGCGCTCGGCAGCAG AGATGTCGGGCGGCATACGGGACGTGCGCGCCGAGGACATCACCGGGCTGACTGGACGCCCCTTCAGGGTGTTCAGCCTCGACACGGG GCGGCTGAACCCAGAGACATACCAACTCTTCGACAAGGTGGAGAAGCACTACGGTATCCACATCGAGTACATGTTCCCGGACCAAGGG CCTCTTCTCTTTCTACGAGGACGGACACCAGGAGTGCTGCAGGGTGAGGAAGGTTCGGCCATTGAGGAGGGCCCTCAAGGGCCTCAAG GCCTGGATCACCGGGCAGCGGAAGGACCAGTCCCCTGGCACCAGGGCGAGCATCCCTGTTGTTCAGGTTGATCCGTCATTTGAAGGGC TGGATGGTGGAGCTGGTAGCTTGATCAAGTGGAACCCTGTGGCTAATGTGGATGGCAAGGATATCTGGACCTTCCTCAGGACCATGGA TGTCCCTGTGAACACCCTGCATGCTCAAGGCTACGTCTCCATTGGGTGCGAGCCGTGCACCAGGCCCGTGTTGCCGGGGCAGCACGAG AGGGAAGGGAGGTGGTGGTGGGAGGACGCCACGGCCAAGGAGTGCGGTCTCCACAAGGGTAACATCGACAAGGAAGGTCAAGACACCC AAGGTCNGGCGTCAACGNCAACGGCTCGGCTGAGGCCAGTGCCCCAGACATCTTCCAGAGCCAGGCAATCGTCAATCTCACCCGTCCC GGGATCGAGAACGGTGATTTGAGAATTCCAGCATCTTTCTGTGGTGTACTTGGTTTCCGGTCTTCTCATGGGGTTGTGTCTACTCTTG GGACCTTACCGAACTCACATAGCCTAGATACCATTGGATGGCTTGCACGAGATCCTCATATACTTAGTCGTGTTGGAGATGCTCTGTT ACCCGTTGCTGCATGTGGACTTAAGGGGAAACTGAGGCCAGTGCCACGTTATGGCAGTA ~2000 Nukleotide

9 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-9 Genomgrößen Virus-Genom5 * = Bakterien-Genom150 * = Kleinstes Pflanzengenom (Arabidopsis Thaliana) * = menschliches Genom * = Gersten-Genom * = größtes Pflanzengenom * =

10 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-10 Grundlagen aus dem Bereich Informatik

11 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-11 Computer und Betriebsysteme wichtigstes Werkzeug der Bioinformatik: Computer verschiedene Kategorien: -Personalcomputer -Großrechner -… Betriebssysteme: -Windows -MacOS -Unix (Solaris, Linux) Frage: Was ist relevant für Bioinformatik? Plattformübergreifende Lösungen bzw. Programmiersprachen: -Java -Perl -Python -…

12 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-12 Internet und WWW Internet basiert auf militärischer Entwicklung in USA ARPANET: Ausfall eines Teils des Netzwerkes führt nicht zum Totalausfall -> Vorgänger des Internets Kommunikationsprotokolle TCP/IP Namenspaten für Internet Internet = über TCP/IP verbundene Netzwerke Entwicklung des WWW 1990/91 durch Tim Berners-Lee (CERN) WWW ist nur ein Angebot (Service) im Internet!!! Moderne Browser (IE, Netscape, Firefox) sind Programme zur Nutzung des Service WWW Primärziel bei Konzeption und Entwicklung: wissenschaftlicher Datenaustausch wichtige Rolle auch in der Bioinformatik! Parallelität zwischen modernen Methoden im Labor (z.B. DNA- Sequenzierung) und Verbreitung der Angebote im WWW zur Bereitstellung von Informationen!!!

13 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-13 Internet - Struktur Verbindung vieler Netze gemeinsames Protokoll keine gemeinsame Steuerung jeder trägt bei stabil durch Redundanz unpolitisch

14 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-14 Vergleich: Was ist ein LAN?

15 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-15 Physikalische Anbindung an das Internet privater Bereich: -analoges Modem -ISDN =Integrated Services Digital Network -(asynchrones) DSL = Digital Subscriber Line -Steckdose oder Kabelanschluss -Satellit -WLAN -… Unternehmen bzw. Forschungseinrichtungen: -Standleitungen zu DFN oder anderen Anbietern Anstieg der Übertragungs- kapazität

16 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-16 Logische Anbindung an das Internet Serviceanbieter: -Vermittlung zwischen Kunden und Internet -Standleitung ans Internet 2 Gruppen mit fließendem Übergang -Internet Service Provider -Content Provider Beipiele: -AOL -T-Online -Freenet -Arcor -1&1 -Alice -…

17 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-17 Internet Services ! ? News -schwarzes Brett FTP -textbasiert, runterladen der Dateien SSH und SCP -Verschlüsselung World Wide Web -kein runterladen notwendig -Navigation durch Hyperlinks -URL = Uniform Ressource Locator Beispiel:

18 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-18 Die Benutzung von Unix Aussage: Linux-Kenntnisse sind elementar, um moderne Bioinformatik Werkzeuge (wie z. B. BLAST) im Hochdurchsatz effizient anwenden zu können!!! Empfehlung: Teilnahme an einem Linux-Kurs oder Installation einer entsprechenden Distribution auf eigenem PC! -> Erhöhung der Chancen im Beruf!!!!

19 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-19 Daten und Informationen Daten: Daten sind Gebilde aus Zeichen oder kontinuierliche Funktionen, die aufgrund bekannter oder unterstellter Abmachungen Information(en) darstellen, vorrangig zum Zweck der Verarbeitung oder als deren Ergebnis.... In der Informatik versteht man beispielsweise unter Daten alles, was sich in einer für einen Computer erkennbaren Weise codieren lässt. [M. G. Zilahi-Szabó, Herausgeber. Kleines Lexikon der Informatik.München, Oldenbourg, 1995.] Informationen: Informationen sind aus Daten geschlussfolgerte Fakten bzw. deren Interpretationen.

20 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-20 Datenbanken etc. Datenbanken etc. [G. Saake, I. Schmitt und C. Türker. Objektdatenbanken Konzepte, Sprachen, Architekturen. International Thomson Publishing, Bonn, 1997.] Datenbank: Eine Datenbank ist eine strukturierte Sammlung von Daten, welche Fakten über spezielle Anwendungen eines modellierten Ausschnittes der Realwelt repräsentiert, die dauerhaft (persistent) und weitgehend redundanzfrei gespeichert wird. Datenbank-Management-System: Die Software, die eine Sammlung von Programmen bereitstellt, welche das anwendungsabhängige Erzeugen, Ändern und Löschen einer Datenbank ermöglicht, wird als Datenbank-Management-System (DBMS) bezeichnet. Datenbanksystem: Unter einem Datenbanksystem (DBS) wird stets die Kombination eines Datenbank-Management-Systems mit einer oder mehreren, unterscheidbaren Datenbanken verstanden.

21 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-21 Datenbanken Datenbank DBMSAnwendung 1Anwendung n... Aufgaben: 1. Integration 2. Operationen 3. Katalog 4. Nutzersichten 5. Konsistenzüberwachung 6. Datenschutz 7. Transaktionen 8. Synchronisation 9. Backup und Recovery [E. F. Codd. Relational Database: A Practical Foundation for Productivity. Communications of the ACM, 25(2):109–117, Februar 1982.] DBS...

22 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-22 Informationssystem persistente Speicherung der Informationen Wiedergewinnung der Informationen basierend auf verschiedenen Abfragekriterien anwendungsspezifische Auswertung und Aufbereitung der gespeicherten Informationen integritätserhaltende Änderungsoperationen Integration von zusätzlichen Informationsquellen: -externe Datenquellen -Informationszugriff über das WWW -kooperierender Zugriff -… Modellierung von Nutzerschnittstellen und Nutzerführung Verteilungsaspekte Bestandteil jedes Informationssystems ist ein DBS!!!

23 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-23 Datenquelle und Flat-File Datenquelle: Eine Datenquelle besteht aus mindestens einem Computer (rechentechnische Einheit), auf dem Daten gespeichert sind und auf die über bestimmte Schnittstellen zugegriffen werden kann. Flat-File: Ein Flat-File ist eine Datei, die eine bestimmte, implizite Struktur besitzt. Ist ein Flat-File auf einem Rechner verfügbar, so wird diese Kombination auch als Datenquelle verstanden. Beispiel: ENTRY EC NAME Ornithine carbamoyltransferase Citrulline phospharylase Ornithine transcarbamylase CLASS Transferases Transferring one-carbon groups Carboxyl- and carbamoyltransferases SYSNAMECarbamoyl-phosphate: L-ornithine carbamoyltransferase...

24 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-24 Datenintegration und Informationsfusion Datenintegration: Die Datenintegration hat das Ziel, die Redundanz zu vermeiden und sie erfordert die einheitliche Verwaltung aller von Anwendungen bzw. von Anwendern benötigten Daten. Informationsfusion: Sie charakterisiert einen Prozess, dessen Aufgabe es ist, Daten oder Informationen aus verschiedenen, zum Teil heterogenen Datenquellen zu kombinieren, zu verdichten, zu interpretieren und daraus Informationen einer neuen Qualität abzuleiten. [G. Saake und A. Heuer. Datenbanken Implementierungstechniken. MITP-Verlag, Bonn, 1999.]

25 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-25 Datenintegration und Informationsfusion: Beispiel

26 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-26 Ansätze zur Datenintegration: Klassifikation © Kai-Uwe Sattler, Magdeburg 2003

27 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-27 Ausgewählte Möglichkeiten zur Datenintegration 1. Hypertextnavigation [P. D. Karp. A Strategy for Database Interoperation. Journal of Computational Biology, 2(4):573–586, 1995.] 2. Föderiertes Datenbanksystem [A. P. Sheth und J. A. Larson. Federated Database Systems for Managing Distributed, Heterogeneous, and Autonomous Databases. ACM Computing Surveys, 22(3):183–236, September 1990.] [S. Conrad. Föderierte Datenbanksysteme: Konzepte der Datenintegration. Springer-Verlag, Berlin/Heidelberg, 1997.] 3. Mediator [G. Wiederhold. Mediators in the Architecture of Future Information Systems. IEEE Computer, 25(3):38–49, März 1992.] 4. Multidatenbanken [P. D. Karp. A Strategy for Database Interoperation. Journal of Computational Biology, 2(4):573–586, 1995.] 5. Data Warehouse [W. H. Inmon. Building the Data Warehouse. John Wiley & Sons, Inc., 2. Auflage, 1996.]

28 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-28 Hypertextnavigation © Jacob Köhler, Bielefeld 2003 Keine echte Datenintegration!

29 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-29 Föderiertes Datenbanksystem (FDBS) © Höding, Türker, Janssen, Sattler, Conrad, Saake, Schmitt, Magdburg 1995

30 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-30 Föderiertes Datenbanksystem (FDBS) Zusammenfassung von mehreren DBS Bezeichnung als Komponenten-DBS (KDBS) Aufrechterhaltung der Autonomie aller KDBS zuerst KDBS immer echtes Datenbanksystem später auch Anbindung von Dateien als Datenquellen wesentlicher Bestandteil ist Föderierungsdienst Aufgabe: Zugriffssteuerung für globale Anwendungen aber: einige Probleme!!!

31 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-31 Mediator © Wiederhold 1992

32 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-32 Mediator Einführung als Alternative zu FDBS Grund: schwieriger Entwurf von großen föderierten Schemata Einsatz von kleinen Vermittlern Mediator: abgeschlossene Softwaremodule mit definierten Schnittstellen keine generelle Verwaltungssoftware (wie Föderierungsdienst) -> viele einzelne Module Besonderheit: kaskadierende Mediatoren Entwicklung von integrierten Schemata in jedem Mediator -> mehre kleinere Schemata -> Einbindung neuer Datenquellen einfacher

33 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-33 Multidatenbanken

34 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-34 Multidatenbanken in DB-Literatur taxonomisch über FDBS, aber in Bioinformatik gleichberechtigter Ansatz! Einsatz einer geeigneter Anfragesprache: Multidatenbankanfragesprache dadurch Definition des verteilten Zugriffs auf Datenquellen Formulierung komplexer Anfragen zur Spezifikation der Informationen und der Datenquelle Realisierung des Zugriffs durch datenquellen-spezifische Treiber Fortsetzung...

35 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-35 Data Warehouse

36 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-36 Data Warehouse Transformation des Inhalts heterogener Datenquellen: -Überführung der Datenquellenschemata in gemeinsames Datenmodell -Modellierung eines integrierten Schema (Probleme ähnlich wie bei FDBS) -Einbindung neuer Datenquellen immer neue Modellierung notwendig Import dieses Resultats in die Data Warehouse Datenbank Realisierung des physischen Zugriffs über Treiber (spezifische Softwaremodule) durch Import Verlust der Autonomie des Datenquellen (KDBS) eine monolithische Datenbank Fortsetzung...

37 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-37 Data Warehouse Arbeit auf Kopie der Originaldaten Vorteil in Bezug auf Verfügbarkeit Nachteil bei Änderung der Originaldaten -> neuer Import laut Definition: -Nicht-Flüchtigkeit Abschwächung -> Ändern oder Löschen zulassen -historische Datensammlung Abschwächung -> keine Zeitreihenanalysen ein Zweck zum Aufbau eines Data Warehouses: Informationsfusion Fortsetzung...

38 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-38 Data Warehouse: Charakteristika Fachorientierung (subject oriented): Zweck des Systems ist nicht die Erfüllung eienr Aufgabe z.B. Personaldatenverwaltung), sondern Modellierung eines spezifischen Anwendungsziels Integrierte Datenbasis (integrated): Verarbeitung von Daten aus mehren verschiedenen Datenquellen (intern oder extern) Nichtflüchtige Datenbasis (non-volatile): Abschwächung! stabil, persistent! Daten im DW werden nicht mehr entfernt oder geändert! Historische Daten (time variant): Abschwächung! Vergleich der Daten über Zeit möglich (Zeitreihenanalysen) Speicherung über längeren Zeitraum © Eike Schallehn, Magdeburg 2003

39 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-39 Data Warehouse: Beispiel-Szenario (I) © Eike Schallehn, Magdeburg 2003

40 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-40 Data Warehouse: Beispiel-Szenario (II) © Eike Schallehn, Magdeburg 2003 Anfragen: -Wie viele Flaschen Bier wurden letzten Monat verkauft? -Wie hat sich der Verkauf von Rotwein im letzten Jahr entwickelt? -Wer sind unsere Top-Kunden? -Von welchen Lieferanten beziehen wir die meisten Kisten? Probleme: -Nutzung externer Quellen (Kundendatenbank, Lieferantendatenbank,...) -Daten mit historischen Bezug

41 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-41 Data Warehouse: Ergebnis(-Würfel) © Eike Schallehn, Magdeburg 2003 Welche Umsätze sind in den Jahren 1998 und 1999 in den Abteilungen Kosmetik, Elektro und Haushaltwaren in den Bundesländern Sachsen- Anhalt und Thüringen angefallen?

42 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-42 Data Warehouse: Ergebnis(-Bericht) © Eike Schallehn, Magdeburg 2003

43 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-43 Plant Data Warehouse am IPK (I)

44 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-44 Plant Data Warehouse am IPK (II) Anfragen: -Wie viele Genbank-Samenproben wurden im letzten Monat verschickt? -Welche Genbank-Accessions wurden im letzten Jahr erfolgreich innerhalb von IPK-Projekten eingesetzt? -Wer sind unsere Top-Kunden unter den Züchtungsunternehmen? -Mit welchen Substanzen (z.B. Enzymen) von welchen Lieferanten wurden die meisten Marker experimentell nachgewiesen und erfolgreich kartiert? Probleme: -Nutzung verschiedener Quellen (GBIS, CR-EST, MOMA, FLAREX,...) -Daten mit historischen Bezug

45 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-45 Bioinformatik in der modernen Biotechnologie Internet

46 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-46 Relationenmodell & Entity-Relationship- Modellierung QUELLE: Thoralf Töpel:Web-basierte Informationssysteme in der molekularen Bioinformatik, Vorlesung, SoSe 05

47 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-47

48 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-48

49 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-49

50 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-50

51 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-51

52 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-52

53 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-53

54 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-54

55 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-55

56 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-56

57 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-57

58 Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-58


Herunterladen ppt "Vorlesung Einführung in die Bioinformatik -Grundlagen U. Scholz & M. Lange Folie #1-1 Interessierende Objekte in der Bioinformatik: Molekularbiologische."

Ähnliche Präsentationen


Google-Anzeigen