Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik1 Multiples Sequenz Alignment Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel.

Ähnliche Präsentationen


Präsentation zum Thema: "3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik1 Multiples Sequenz Alignment Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel."—  Präsentation transkript:

1 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik1 Multiples Sequenz Alignment Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel heute aus Buch von Arthur Lesk

2 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik2 Einfach Schwierig wegen Insertionen und Deletionen (indels) Alignments können einfach oder schwer sein GCGGCCCA TCAGGTACTT GGTGG GCGGCCCA TCAGGTAGTT GGTGG GCGTTCCA TCAGCTGGTT GGTGG GCGTCCCA TCAGCTAGTT GGTGG GCGGCGCA TTAGCTAGTT GGTGA ******** ********** ***** TTGACATG CCGGGG---A AACCG TTGACATG CCGGTG--GT AAGCC TTGACATG -CTAGG---A ACGCG TTGACATG -CTAGGGAAC ACGCG TTGACATC -CTCTG---A ACGCG ******** ?????????? *****

3 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik3 Homo sapiens DjlA protein Escherichia coli DjlA protein Protein-Alignment kann durch tertiäre Strukturinformationen geführt werden nur so kann man letztlich auch bewerten, ob ein Sequenzalignment korrekt ist.

4 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik4 Homologie: Ähnlichkeit, die durch Abstammung von einem gemeinsamen Ursprungsgen herrührt – die Identifizierung und Analyse von Homologien ist eine zentrale Aufgabe der Phylogenie. Ein Alignment ist eine Hypothese für die positionelle Homologie zwischen Basenpaaren bzw. Aminosäuren. Definition von Homologie

5 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik5 MSA für Thioredoxin-Familie Farbe AminosäuretypAminosäuren gelbklein, wenig polarGly, Ala, Ser, Thr grünhydrophobCys, Val, Ile, Leu Pro, Phe, Tyr, Met, Trp violettpolarAsn, Gln, His rotnegativ geladenAsp, Glu blaupositiv geladenLys, Arg

6 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik6 Infos aus MSA von Thioredoxin-Familie Thioredoxin: aus 5 beta-Strängen bestehendes beta-Faltblatt, das auf beiden Seiten von alpha-Helices flankiert ist. gemeinsamer Mechanismus: Reduktion von Disulfidbrücken in Proteinen

7 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik7 Infos aus MSA von Thioredoxin-Familie 1) Die am stärksten konservierten Abschnitte entsprechen wahrscheinlich dem aktiven Zentrum. Disulfidbrücke zwischen Cys32 und Cys35 gehört zu dem konservierten WCGPC[K oder R] Motiv. Andere konservierte Sequenzabschnitte, z.B. Pro76Thr77 und Gly92Gly93 sind an der Substratbindung beteiligt.

8 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik8 Infos aus MSA von Thioredoxin-Familie 2) Abschnitte mit vielen Insertionen und Deletionen entsprechen vermutlich Schleifen an der Oberfläche. Eine Position mit einem konservierten Gly oder Pro läßt auf eine Wendung der Kette (turn) schließen.

9 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik9 Infos aus MSA von Thioredoxin-Familie 3) Ein konserviertes Muster hydrophober Bausteine mit dem Abstand 2 (d.h., an jeder zweiten Position), bei dem die dazwischenliegenden Bausteine vielfältiger sind und auch hydrophil sein können, läßt auf ein -Faltblatt an der Moleküloberfläche schließen.

10 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik10 Infos aus MSA von Thioredoxin-Familie 4) Ein konserviertes Muster hydrophober Aminosäurereste mit dem Abstand von ungefähr 4 läßt auf eine -Helix schließen.

11 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik11 Infos aus MSA von Thioredoxin-Familie Die Thioredoxine sind Teil einer Superfamilie, zu der auch viele weiter entfernte homologe Protein gehören, z.B. Glutaredoxin (Wasserstoffdonor für die Reduktion von Ribonukleotiden bei der DNA-Synthese) Protein-Disulfidisomerase (katalysiert bei der Proteinfaltung den Austausch falsch gefalteter Disulfidbrücken) Phosducin (Regulator in G-Protein-abhängigen Signalübertragungswegen) Glutathion-S-Transferasen (Proteine der chemischen Abwehr). Die Tabelle des MSAs für Thioredoxinsequenzen enthält implizit auch Muster, die man zur Identifizierung dieser entfernteren Verwandten nutzen kann.

12 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik12 Es gibt im wesentlichen 3 unterschiedliche Vorgehensweisen: (1) Manuell (2) Automatisch (3) Kombiniert Multiples Sequenz-Alignment - Methoden

13 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik13 manuelles Alignment bietet sich an falls – Alignment einfach ist. – es zusätzliche (strukturelle) Information gibt. – automatische Alignment –Methoden in lokalen Minima feststecken. – ein automatisch erzeugtes Alignment manuell verbessert werden kann. Gründe für manuelles Alignment

14 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik14 2 Methoden: Dynamische Programmierung –betrache 2 Proteinsequenzen von 100 Aminosäuren Länge. -wenn es Sekunden dauert, diese beiden Sequenzen erschöpfend zu alignieren, dann wird es Sekunden dauern um 3 Sequenzen zu alignieren, Sekunden für 4 sequences und x10 34 Jahre für 20 Sequenzen. Progressives Alignment multiples Sequenzalignment

15 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik15 berechne zunächst paarweise Alignments für 3 Sequenzen wird Würfel aufgespannt: D.h. dynamische Programmierung hat nun Komplexität n1 * n2 * n3 mit den Sequenzlängen n1, n2, n3. Sehr aufwändig!Versuche, Suchraum einzuschränken. dynamische Programmierung mit MSA Programm

16 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik16 dynamische Programmierung mit MSA Programm Links: Baum für 5 Sequenzen ohne Paarung von Sequenzen. Neighbour-joining Methode: berechne Summe aller Kantenlängen S = a + b + c + d + e (Kantenlängen sind bekannt) In diesem Fall seien sich A und B am nächsten. Konstruiere daher den Baum rechts. Generell: Verbinde die Sequenzpaare mit den kürzesten Abständen … Man erhält den Baum mit der kleinsten Summe der Kantenlängen. Konstruiere anhand phylogenetischem Baum ein versuchsweises Multiples Sequenz Alignment.

17 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik17 Dieses Alignment dient dazu, den möglichen Raum inmitten des Würfels einzugrenzen, in dem das beste MSA zu finden sein sollte. Grosse Rechenersparnis! dynamische Programmierung mit MSA Programm

18 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik18 wurde von Feng & Doolittle 1987 vorgestellt ist eigentlich eine heuristische Methode. Daher ist nicht garantiert, das optimale Alignment zu finden. benötigt (n-1) + (n-2) + (n-3)... (n-n+1) paarweise Sequenzalignments als Ausgangspunkt. weitverbreitete Implementation in Clustal (Des Higgins) ClustalW ist eine neuere Version, in der den Parameter für Sequenzen und Programm Gewichte (weights) zugeteilt werden. Progressives Alignment

19 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik19 Schnelle paarweise Alignments: berechne Matrix der Abstände 1 PEEKSAVTALWGKVN--VDEVGG 2 GEEKAAVLALWDKVN--EEEVGG 3 PADKTNVKAAWGKVGAHAGEYGA 4 AADKTNVKAAWSKVGGHAGEYGA 5 EHEWQLVLHVWAKVEADVAGHGQ Hbb_Human 1 - Hbb_Horse Hba_Human Hba_Horse Myg_Whale Hbb_Human Hbb_Horse Hba_Horse Hba_Human Myg_Whale alpha-helices Nachbar-Verbindungs- Baumdiagramm progressive Alignments entsprechend dem Baumdiagramm CLUSTAL W Überblick der ClustalW Prozedur

20 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik20 Berechne alle möglichen paarweisen Alignments von Sequenzpaaren. Es gibt (n-1)+(n-2)...(n-n+1) Möglichkeiten. Berechne aus diesen isolierten paarweisen Alignments den Abstand zwischen jedem Sequenzpaar. Erstelle eine Abstandsmatrix. ClustalW- Paarweise Alignments

21 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik21 Clustal W - Nachbarschaftsbaum aus den paarweisen Distanzen wird ein Nachbarschafts-Baum erstellt Dieser Baum gibt die Reihenfolge an, in der das progressive Alignment ausgeführt werden wird.

22 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik22 aligniere die beiden ähnlichsten Sequenzen zuerst. dieses Alignment ist dann fest und wird nicht mehr angetastet. Falls später ein GAP eingeführt werden muss, wird er in beiden Sequenzen an der gleichen Stelle eingeführt. Deren relatives Alignment bleibt unverändert. Multiples Alignment - Erstes Paar

23 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik23 Ziehe den Baum heran um festzulegen, welches Alignment als nächstes durchgeführt werden soll: –aligniere eine dritte Sequenz zu den ersten beiden oder –aligniere zwei total verschiedene Sequenzen miteinander. Option 1 Option 2 Clustal W – Zeit der Entscheidung

24 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik24 Wenn beim Alignment einer dritten Sequenz mit den ersten beiden eine Lücke eingefügt werden muss um das Alignment zu verbessern, werden beide als Einzelsequenzen betrachtet. + ClustalW- Alternative 1

25 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik25 Falls, andererseits, zwei getrennte Sequenzen aligniert werden müssen, werden diese zunächst miteinander aligniert. + ClustalW- Alternative 2

26 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik26 gctcgatacgatacgatgactagcta gctcgatacaagacgatgacagcta gctcgatacacgatgactagcta gctcgatacacgatgacgagcga ctcgaacgatacgatgactagct gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta Progressives Alignment – 1. Schritt

27 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik27 gctcgatacgatacgatgactagcta gctcgatacaagacgatgacagcta gctcgatacacgatgactagcta gctcgatacacgatgacgagcga ctcgaacgatacgatgactagct gctcgatacacgatgactagcta gctcgatacacgatgacgagcga Progressives Alignment – 2. Schritt

28 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik28 gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta + gctcgatacacgatgactagcta gctcgatacacgatgacgagcga gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta Gctcgatacacga---tgactagcta Gctcgatacacga---tgacgagcga Progressives Alignment – 3. Schritt

29 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik29 gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta gctcgatacacga---tgactagcta gctcgatacacga---tgacgagcga + ctcgaacgatacgatgactagct gctcgatacgatacgatgactagcta Gctcgatacaagacgatgac-agcta gctcgatacacga---tgactagcta gctcgatacacga---tgacgagcga -ctcga-acgatacgatgactagct- Progressives Alignment – letzter Schritt

30 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik30 Vorteil: –Geschwindigkeit. Nachteile: –keine objektive Funktion. –Keine Möglichkeit zu quantifizieren ob Alignment gut oder schlecht ist. –Keine Möglichkeit festzustellen, ob das Alignment korrekt ist. ClustalW- Vor- und Nachteile

31 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik31 Mögliche Probleme: –in ein lokales Minimum zu geraten. Falls zu einem frühen Zeitpunkt ein Fehler im Alignment eingebaut wird, kann dieser später nicht mehr korrigiert werden. –Zufälliges Alignment. ClustalW - Lokales Minimum

32 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik32 Sollen all Sequenzen gleich behandelt werden? Obwohl manche Sequenzen eng verwandt und andere entfernt verwandt sind? Sollen alle Positionen der Sequenzen gleich behandelt werden? Obwohl sie unterschiedliche Funktionen und Positionen in der dreidimensionalen Strukturen haben können? Genauigkeit des Alignments verbessern

33 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik33 Sequenzgewichtung Variable Substitutionsmatrizen Residuen-spezifische Gap-Penalties und verringerte Penalties in hydrophilen Regionen (externe Regionen von Proteinsequenzen), bevorzugt Gaps in Loops anstatt im Proteinkern. Positionen in frühen Alignments, an denen Gaps geöffnet wurden, erhalten lokal reduzierte Gap Penalties um in späteren Alignments Gaps an den gleichen Stellen zu bevorzugen ClustalW- Besonderheiten

34 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik34 Zwei Parameter sind festzulegen (es gibt Default-Werte, aber man sollte sich bewusst sein, dass diese abgeändert werden können): Die GOP- Gap Opening Penalty ist aufzubringen um eine Lücke in einem Alignment zu erzeugen Die GEP- Gap Extension Penalty ist aufzubringen um diese Lücke um eine Position zu verlängern. ClustalW- vom Benutzer festzulegende Parameter

35 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik35 Bevor irgendein Sequenzpaar aligniert wird, wird eine Tabelle von GOPs erstellt für jede Position der beiden Sequenzen. Die GOP werden positions-spezifisch behandelt und können über die Sequenzlänge variieren. Falls ein GAP an einer Position existiert, werden die GOP und GEP penalties herabgesetzt – und alle anderen Regeln treffen nicht zu. Daher wird die Bildung von Gaps an Positionen wahrscheinlicher, an denen bereits Gaps existieren. Positions-spezifische Gap penalties

36 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik36 Solange kein GAP offen ist, wird GOP hochgesetzt falls die Position innerhalb von 8 Residuen von einem bestehenden Gap liegt. Dadurch werden Gaps vermieden, die zu eng beieinander liegen. An jeder Position innerhalb einer Reihe von hydrophilen Residuen wird GOP herabgesetzt, da diese gewöhnlich in Loop-Regionen von Proteinstrukturen liegen. Eine Reihe von 5 hydrophilen Residuen gilt als hydrophiler stretch. Die üblichen hydrophilen Residuen sind: DAspKLysPPro EGluNAsnRArg GGlyQGlnSSer Dies kann durch den Benutzer geändert werden. Vermeide zu viele Gaps

37 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik37 Die am meisten divergenten Sequenzen (also am stärksten von allen anderen Sequenzen verschiedenen) sind gewönlich am schwierigsten zu alignieren Es ist manchmal besser, ihr Alignment auf einen späteren Zeitpunkt zu verschieben (nachdem die einfacheren Sequenzen aligniert wurden) Man kann dazu einen Cutoff wählen (der Default liegt bei 40% Identität). Divergente Sequenzen

38 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik38 Progressives Alignment ist ein mathematischer Vorgang, der völlig unabhängig von der biologischen Realität abläuft. Es kann eine sehr gute Abschätzung sein. Es kann eine unglaublich schlechte Abschätzung sein. Erfordert Input und Erfahrung des Benutzers. Sollte mit Vorsicht verwendet werden. Kann (gewöhnlich) manuell verbessert werden. Es hilft oft, farbliche Darstellungen zu wählen. Je nach Einsatzgebiet sollte der Benutzer in der Lage sein, die zuverlässigen Regionen des Alignments zu beurteilen. Für phylogenetische Rekonstruktionen sollte man nur die Positionen verwenden, für die eine zweifelsfreie Hypothese über positionelle Homologie vorliegt. Tips für progressives Alignment

39 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik39 Es macht wenig Sinn, proteinkodierende DNS-Abschnitte zu alignieren! ATGCTGTTAGGG ATGCTCGTAGGG ATGCT-GTTAGGG ATGCTCGT-AGGG Das Ergebnis kann sehr unplausibel sein und entspricht eventuell nicht dem biologischen Prozess. Es ist viel sinnvoller, die Sequenzen in die entsprechenden Proteinsequenzen zu übersetzen, diese zu alignieren und dann in den DNS-Sequenzen an den Stellen Gaps einzufügen, an denen sie im Aminosäure-Alignment zu finden sind. Alignment von Protein-kodierenden DNS-Sequenzen

40 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik40 GDE- The Genetic Data Environment (UNIX) CINEMA- Java applet available from: –http://www.biochem.ucl.ac.uk Seqapp/Seqpup- Mac/PC/UNIX available from: –http://iubio.bio.indiana.edu SeAl for Macintosh, available from: –http://evolve.zoo.ox.ac.uk/Se-Al/Se-Al.html BioEdit for PC, available from: –http://www.mbio.ncsu.edu/RNaseP/info/programs/BIOEDIT/bioedit.html Software für manuelle Alignments

41 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik41 Sequenz: MGGRSSCEDP GCPRDEERAP RMGCMKSKFL QVGGNTFSKT ETSASPHCPV YVPDPTSTIK PGPNSHNSNT PGIREAGSED IIVVALYDYE AIHHEDLSFQ KGDQMVVLEE SGEWWKARSL ATRKEGYIPS NYVARVDSLE TEEWFFKGIS RKDAERQLLA PGNMLGSFMI RDSETTKGSY SLSVRDYDPR QGDTVKHYKI RTLDNGGFYI SPRSTFSTLQ ELVDHYKKGN DGLCQKLSVP CMSSKPQKPW EKDAWEIPRE SLKLEKKLGA GQFGEVWMAT YNKHTKVAVK TMKPGSMSVE AFLAEANVMK TLQHDKLVKL HAVVTKEPIY IITEFMAKGS LLDFLKSDEG SKQPLPKLID FSAQIAEGMA FIEQRNYIHR DLRAANILVS ASLVCKIADF GLARVIEDNE YTAREGAKFP IKWTAPEAIN FGSFTIKSDV WSFGILLMEI VTYGRIPYPG MSNPEVIRAL ERGYRMPRPE NCPEELYNIM MRCWKNRPEE RPTFEYIQSV LDDFYTATES QYQQQP SMART ergibt: Beispiel: Src-Kinase HcK

42 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik42 Kinase-Einheit Beispiel: Src-Kinase HcK Protein Data Bank 1ATP

43 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik43 SH3 Domäne Src homology 3 (SH3) Domänen binden an Zielproteine mit Sequenzen, die Proline und hydrophobe Aminosäuren enthalten. Pro-enthaltende Polypeptide können an SH3 in zwei verschiedenen Orientierungen binden. SH3 Domänen sind kleine Proteinmodule von ungefähr 50 Residuen Länge. Man findet sie in vielen intrazellulären oder Membran-assoziierten Proteinen … Beispiel: Src-Kinase HcK CATH: 1abo

44 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik44 SH2 Domäne Die Src homology 2 (SH2) Domäne ist eine Proteindomäne mit etwa 100 Aminosäuren. SH2 Domänen funktionieren als Regelmodule von intrazellulären Signalkaskaden indem sie mit grosser Affinität an Phospho-Tyrosin enthaltende Peptide binden. SH2 Domänen findet man oft zusammen mit SH3 Domänen … Ihre Struktur ist alpha+beta … Beispiel: Src-Kinase HcK CATH: 1g83 1fbz1aot

45 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik45 Beispiel: Src-Kinase HcK

46 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik46 Was kann man mit modularem Denken erreichen?

47 3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik47 Progressive Alignments sind die am weitesten verbreitete Methode für multiple Sequenzalignments. Sehr sensitive Methode ebenfalls: Hidden Markov Modelle (HMMer) Multiples Sequenzalignment ist nicht trivial. Manuelle Nacharbeit kann in Einzelfällen das Alignment verbessern. Multiples Sequenzalignment erlaubt Denken in Proteinfamilien und – funktionen. Zusammenfasusng


Herunterladen ppt "3. Vorlesung WS 2005/2006 Softwarewerkzeuge der Bioinformatik1 Multiples Sequenz Alignment Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel."

Ähnliche Präsentationen


Google-Anzeigen