Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik1 V3 - Multiples Sequenz Alignment und Phylogenie Literatur: Kapitel 4 in Buch von David Mount.

Ähnliche Präsentationen


Präsentation zum Thema: "3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik1 V3 - Multiples Sequenz Alignment und Phylogenie Literatur: Kapitel 4 in Buch von David Mount."—  Präsentation transkript:

1 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik1 V3 - Multiples Sequenz Alignment und Phylogenie Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel heute aus Buch von Arthur Lesk

2 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik2 Homologie: Ähnlichkeit, die durch Abstammung von einem gemeinsamen Ursprungsgen herrührt – die Identifizierung und Analyse von Homologien ist eine zentrale Aufgabe der Phylogenie. Ein Alignment ist eine Hypothese für die positionelle Homologie zwischen Basenpaaren bzw. Aminosäuren. Definition von Homologie

3 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik3 Einfach Schwierig wegen Insertionen und Deletionen (indels) Alignments können einfach oder schwer sein GCGGCCCA TCAGGTACTT GGTGG GCGGCCCA TCAGGTAGTT GGTGG GCGTTCCA TCAGCTGGTT GGTGG GCGTCCCA TCAGCTAGTT GGTGG GCGGCGCA TTAGCTAGTT GGTGA ******** ********** ***** TTGACATG CCGGGG---A AACCG TTGACATG CCGGTG--GT AAGCC TTGACATG -CTAGG---A ACGCG TTGACATG -CTAGGGAAC ACGCG TTGACATC -CTCTG---A ACGCG ******** ?????????? ***** Kann man beweisen, dass ein Alignment korrekt ist?

4 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik4 Homo sapiens DjlA protein Escherichia coli DjlA protein Protein-Alignment kann durch tertiäre Strukturinformationen geführt werden nur so kann man letztlich bewerten, ob ein Sequenzalignment korrekt ist. Beweisen im strikten Sinne kann man dies nie. Gaps eines Alignments sollten vorwiegend in Loops liegen, nicht in Sekundär- struktur- elementen.

5 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik5 MSA für Thioredoxin-Familie Farbe AminosäuretypAminosäuren gelbklein, wenig polarGly, Ala, Ser, Thr grünhydrophobCys, Val, Ile, Leu Pro, Phe, Tyr, Met, Trp violettpolarAsn, Gln, His rotnegativ geladenAsp, Glu blaupositiv geladenLys, Arg

6 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik6 Infos aus MSA von Thioredoxin-Familie Thioredoxin: aus 5 beta-Strängen bestehendes beta-Faltblatt, das auf beiden Seiten von alpha-Helices flankiert ist. gemeinsamer Mechanismus: Reduktion von Disulfidbrücken in Proteinen

7 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik7 Infos aus MSA von Thioredoxin-Familie 1) Die am stärksten konservierten Abschnitte entsprechen wahrscheinlich dem aktiven Zentrum. Disulfidbrücke zwischen Cys32 und Cys35 gehört zu dem konservierten WCGPC[K oder R] Motiv. Andere konservierte Sequenzabschnitte, z.B. Pro76Thr77 und Gly92Gly93 sind an der Substratbindung beteiligt.

8 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik8 Infos aus MSA von Thioredoxin-Familie 2) Abschnitte mit vielen Insertionen und Deletionen entsprechen vermutlich Schleifen an der Oberfläche. Eine Position mit einem konservierten Gly oder Pro lässt auf eine Wendung der Kette (turn) schließen.

9 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik9 Infos aus MSA von Thioredoxin-Familie 3) Ein konserviertes Muster hydrophober Bausteine mit dem Abstand 2 (d.h., an jeder zweiten Position), bei dem die dazwischenliegenden Bausteine vielfältiger sind und auch hydrophil sein können, läßt auf ein -Faltblatt an der Moleküloberfläche schließen.

10 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik10 Infos aus MSA von Thioredoxin-Familie 4) Ein konserviertes Muster hydrophober Aminosäurereste mit dem Abstand von ungefähr 4 läßt auf eine -Helix schließen.

11 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik11 Infos aus MSA von Thioredoxin-Familie Die Thioredoxine sind Teil einer Superfamilie, zu der auch viele weiter entfernte homologe Protein gehören, z.B. Glutaredoxin (Wasserstoffdonor für die Reduktion von Ribonukleotiden bei der DNA-Synthese) Protein-Disulfidisomerase (katalysiert bei der Proteinfaltung den Austausch falsch gefalteter Disulfidbrücken) Phosducin (Regulator in G-Protein-abhängigen Signalübertragungswegen) Glutathion-S-Transferasen (Proteine der chemischen Abwehr). Die Tabelle des MSAs für Thioredoxinsequenzen enthält implizit Muster, die man zur Identifizierung dieser entfernteren Verwandten nutzen kann.

12 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik12 Es gibt im wesentlichen 3 unterschiedliche Vorgehensweisen: (1) Manuell ein manuelles Alignment bietet sich an falls Alignment einfach ist. es zusätzliche (strukturelle) Information gibt automatische Alignment –Methoden in lokalen Minima feststecken. ein automatisch erzeugtes Alignment manuell verbessert werden kann. (2) Automatisch (3) Kombiniert Multiples Sequenz-Alignment - Methoden

13 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik13 Hier gibt es vor allem folgende 2 wichtigen Methoden: Dynamische Programmierung –liefert garantiert das optimale Alignment! –aber: betrache 2 Proteinsequenzen von 100 Aminosäuren Länge. wenn es Sekunden dauert, diese beiden Sequenzen erschöpfend zu alignieren, dann wird es Sekunden dauern um 3 Sequenzen zu alignieren, Sekunden für 4 Sequenzen und x10 34 Jahre für 20 Sequenzen. Progressives Alignment Automatisches multiples Sequenzalignment

14 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik14 berechne zunächst paarweise Alignments für 3 Sequenzen wird Würfel aufgespannt: D.h. dynamische Programmierung hat nun Komplexität n1 * n2 * n3 mit den Sequenzlängen n1, n2, n3. Sehr aufwändig!Versuche, Suchraum einzuschränken und nur einen kleinen Teil des Würfels abzusuchen. dynamische Programmierung mit MSA Programm

15 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik15 wurde von Feng & Doolittle 1987 vorgestellt ist eine heuristische Methode. Daher ist nicht garantiert, das optimale Alignment zu finden. benötigt (n-1) + (n-2) + (n-3)... (n-n+1) paarweise Sequenzalignments als Ausgangspunkt. weitverbreitete Implementation in Clustal (Des Higgins) ClustalW ist eine neuere Version, in der den Parameter für Sequenzen und Programm Gewichte (weights) zugeteilt werden. Progressives Alignment

16 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik16 Berechne alle möglichen paarweisen Alignments von Sequenzpaaren. Es gibt (n-1)+(n-2)...(n-n+1) Möglichkeiten. Berechne aus diesen isolierten paarweisen Alignments den Abstand zwischen jedem Sequenzpaar. Erstelle eine Abstandsmatrix. aus den paarweisen Distanzen wird ein Nachbarschafts-Baum erstellt Dieser Baum gibt die Reihenfolge an, in der das progressive Alignment ausgeführt werden wird. ClustalW- Paarweise Alignments

17 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik17 Schnelle paarweise Alignments: berechne Matrix der Abstände 1 PEEKSAVTALWGKVN--VDEVGG 2 GEEKAAVLALWDKVN--EEEVGG 3 PADKTNVKAAWGKVGAHAGEYGA 4 AADKTNVKAAWSKVGGHAGEYGA 5 EHEWQLVLHVWAKVEADVAGHGQ Hbb_Human 1 - Hbb_Horse Hba_Human Hba_Horse Myg_Whale Hbb_Human Hbb_Horse Hba_Horse Hba_Human Myg_Whale alpha-helices Nachbar-Verbindungs- Baumdiagramm progressive Alignments entsprechend dem Baumdiagramm CLUSTAL W Überblick der ClustalW Prozedur

18 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik18 aligniere die beiden ähnlichsten Sequenzen zuerst. dieses Alignment ist dann fest und wird nicht mehr angetastet. Falls später ein GAP eingeführt werden muss, wird er in beiden Sequenzen an der gleichen Stelle eingeführt. Deren relatives Alignment bleibt unverändert. Multiples Alignment - Erstes Paar

19 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik19 Ziehe den Baum heran um festzulegen, welches Alignment als nächstes durchgeführt werden soll: –aligniere eine dritte Sequenz zu den ersten beiden oder –aligniere zwei total verschiedene Sequenzen miteinander. Option 1 Option 2 Clustal W – Zeit der Entscheidung

20 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik20 Wenn beim Alignment einer dritten Sequenz mit den ersten beiden eine Lücke eingefügt werden muss um das Alignment zu verbessern, werden beide als Einzelsequenzen betrachtet. + ClustalW- 2 Alternativen + Falls, andererseits, zwei getrennte Sequenzen aligniert werden müssen, werden diese zunächst miteinander aligniert.

21 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik21 gctcgatacgatacgatgactagcta gctcgatacaagacgatgacagcta gctcgatacacgatgactagcta gctcgatacacgatgacgagcga ctcgaacgatacgatgactagct gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta Progressives Alignment – 1. Schritt

22 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik22 gctcgatacgatacgatgactagcta gctcgatacaagacgatgacagcta gctcgatacacgatgactagcta gctcgatacacgatgacgagcga ctcgaacgatacgatgactagct gctcgatacacgatgactagcta gctcgatacacgatgacgagcga Progressives Alignment – 2. Schritt

23 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik23 gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta + gctcgatacacgatgactagcta gctcgatacacgatgacgagcga gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta gctcgatacacga---tgactagcta gctcgatacacga---tgacgagcga Progressives Alignment – 3. Schritt

24 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik24 gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta gctcgatacacga---tgactagcta gctcgatacacga---tgacgagcga + ctcgaacgatacgatgactagct gctcgatacgatacgatgactagcta gctcgatacaagacgatgac-agcta gctcgatacacga---tgactagcta gctcgatacacga---tgacgagcga -ctcga-acgatacgatgactagct- Progressives Alignment – letzter Schritt

25 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik25 Vorteil: –Geschwindigkeit. Nachteile: –keine objektive Funktion. –Keine Möglichkeit zu quantifizieren ob Alignment gut oder schlecht ist (vgl. E-value für BLAST) –Keine Möglichkeit festzustellen, ob das Alignment korrekt ist Mögliche Probleme: –Prozedur kann in ein lokales Minimum geraten. D.h. falls zu einem frühen Zeitpunkt ein Fehler im Alignment eingebaut wird, kann dieser später nicht mehr korrigiert werden. –Zufälliges Alignment. ClustalW- Vor- und Nachteile

26 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik26 Sollen all Sequenzen gleich behandelt werden? Obwohl manche Sequenzen eng verwandt und andere entfernt verwandt sind? Sollen alle Positionen der Sequenzen gleich behandelt werden? Obwohl sie unterschiedliche Funktionen und Positionen in der dreidimensionalen Strukturen haben können? Genauigkeit des Alignments verbessern

27 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik27 Sequenzgewichtung Variable Substitutionsmatrizen Residuen-spezifische Gap-Penalties und verringerte Penalties in hydrophilen Regionen (externe Regionen von Proteinsequenzen), bevorzugt Gaps in Loops anstatt im Proteinkern. Positionen in frühen Alignments, an denen Gaps geöffnet wurden, erhalten lokal reduzierte Gap Penalties um in späteren Alignments Gaps an den gleichen Stellen zu bevorzugen ClustalW- Besonderheiten

28 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik28 Zwei Parameter sind festzulegen (es gibt Default-Werte, aber man sollte sich bewusst sein, dass diese abgeändert werden können): Die GOP- Gap Opening Penalty ist aufzubringen um eine Lücke in einem Alignment zu erzeugen Die GEP- Gap Extension Penalty ist aufzubringen um diese Lücke um eine Position zu verlängern. ClustalW- vom Benutzer festzulegende Parameter

29 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik29 Bevor irgendein Sequenzpaar aligniert wird, wird eine Tabelle von GOPs erstellt für jede Position der beiden Sequenzen. Die GOP werden positions-spezifisch behandelt und können über die Sequenzlänge variieren. Falls ein GAP an einer Position existiert, werden die GOP und GEP penalties herabgesetzt – und alle anderen Regeln treffen nicht zu. Daher wird die Bildung von Gaps an Positionen wahrscheinlicher, an denen bereits Gaps existieren. Positions-spezifische Gap penalties

30 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik30 Solange kein GAP offen ist, wird GOP hochgesetzt falls die Position innerhalb von 8 Residuen von einem bestehenden Gap liegt. Dadurch werden Gaps vermieden, die zu eng beieinander liegen. An jeder Position innerhalb einer Reihe von hydrophilen Residuen wird GOP herabgesetzt, da diese gewöhnlich in Loop-Regionen von Proteinstrukturen liegen. Eine Reihe von 5 hydrophilen Residuen gilt als hydrophiler stretch. Die üblichen hydrophilen Residuen sind: DAspKLysPPro EGluNAsnRArg GGlyQGlnSSer Dies kann durch den Benutzer geändert werden. Vermeide zu viele Gaps

31 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik31 Progressives Alignment ist ein mathematischer Vorgang, der völlig unabhängig von der biologischen Realität abläuft. Es kann eine sehr gute Abschätzung sein. Es kann eine unglaublich schlechte Abschätzung sein. Erfordert Input und Erfahrung des Benutzers. Sollte mit Vorsicht verwendet werden. Kann (gewöhnlich) manuell verbessert werden. Es hilft oft, farbliche Darstellungen zu wählen. Je nach Einsatzgebiet sollte der Benutzer in der Lage sein, die zuverlässigen Regionen des Alignments zu beurteilen. Für phylogenetische Rekonstruktionen sollte man nur die Positionen verwenden, für die eine zweifelsfreie Hypothese über positionelle Homologie vorliegt. Tips für progressives Alignment

32 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik32 Es macht wenig Sinn, proteinkodierende DNS-Abschnitte zu alignieren! ATGCTGTTAGGG ATGCTCGTAGGG ATGCT-GTTAGGG ATGCTCGT-AGGG Das Ergebnis kann sehr unplausibel sein und entspricht eventuell nicht dem biologischen Prozess. Es ist viel sinnvoller, die Sequenzen in die entsprechenden Proteinsequenzen zu übersetzen, diese zu alignieren und dann in den DNS-Sequenzen an den Stellen Gaps einzufügen, an denen sie im Aminosäure-Alignment zu finden sind. Alignment von Protein-kodierenden DNS-Sequenzen

33 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik33 Progressive Alignments sind die am weitesten verbreitete Methode für multiple Sequenzalignments. Sehr sensitive Methode ebenfalls: Hidden Markov Modelle (HMMer) Multiples Sequenzalignment ist nicht trivial. Manuelle Nacharbeit kann in Einzelfällen das Alignment verbessern. Multiples Sequenzalignment erlaubt Denken in Proteinfamilien und – funktionen. Zusammenfassung

34 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik34 Prediction of Phylogenies based on single genes Material of this lecture taken from - chapter 6, DW Mount Bioinformatics and from Julian Felsensteins book. A phylogenetic analysis of a family of related nucleic acid or protein sequences is a determination of how the family might have been derived during evolution. Placing the sequences as outer branches on a tree, the evolutionary relationships among the sequences are depicted. Phylogenies, or evolutionary trees, are the basic structures to describe differences between species, and to analyze them statistically. They have been around for over 140 years. Statistical, computational, and algorithmic work on them is ca. 40 years old.

35 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik35 3 main approaches in single-gene phylogeny - maximum parsimony - distance matrix - maximum likelihood (not covered here) Popular programs: PHYLIP (phylogenetic inference package – J Felsenstein) PAUP (phylogenetic analysis using parsimony – Sinauer Assoc

36 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik36 Parsimony methods Edwards & Cavalli-Sforza (1963): that evolutionary tree is to be preferred that involves the minimum net amount of evolution. seek that phylogeny on which, when we reconstruct the evolutionary events leading to our data, there are as few events as possible. (1) We must be able to make a reconstruction of events, involving as few events as possible, for any proposed phylogeny. (2) We must be able to search among all possible phylogenies for the one or ones that minimize the number of events.

37 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik37 A simple example Suppose that we have 5 species, each of which has been scored for 6 characters (0,1) We will allow changes 0 1 and 1 0. The initial state at the root of a tree may be either state 0 or state 1.

38 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik38 Evaluating a particular tree To find the most parsimonious tree, we must have a way of calculating how many changes of state are needed on a given tree. This tree represents the phylogeny of character 1. Reconstruct phylogeny of character 1 on this tree.

39 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik39 Evaluating a particular tree There are 2 equally good reconstructions, each involving just one change of character state. They differ in which state they assume at the root of the tree, and they differ in which branch they place the single change.

40 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik40 Evaluating a particular tree 3 equally good reconstructions for character 2, which needs two changes of state.

41 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik41 Evaluating a particular tree A single reconstruction for character 3, involving one change of state.

42 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik42 on the right: 2 reconstructions for character 4 and 5 because these characters have identical patterns. single reconstruction for character 6, one change of state. Evaluating a particular tree

43 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik43 Evaluating a particular tree The total number of changes of character state needed on this tree is = 9 Reconstruction of the changes in state on this tree

44 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik44 Evaluating a particular tree Alternative tree with only 8 changes of state. The minimum number of changes of state would be 6, as there are 6 characters that can each have 2 states. Thus, we have two extra changes called homoplasmy.

45 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik45 Finding the best tree by heuristic search The obvious method for searching for the most parsimonious tree is to consider ALL trees and evaluate each one. Unfortunately, generally the number of possible trees is too large. use heuristic search methods that attempt to find the best trees without looking at all possible trees. (1) Make an initial estimate of the tree and make small rearrangements of it = find neighboring trees. (2) If any of these neighbors are better, consider them and continue search.

46 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik46 Counting evolutionary changes 2 related dynamic programming algorithms: Fitch (1971) and Sankoff (1975) - evaluate a phylogeny character by character - for each character, consider it as rooted tree, placing the root wherever seems appropriate. - update some information down a tree; when we reach the bottom, the number of changes of state is available. Do not actually locate changes or reconstruct interior states at the nodes of the tree.

47 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik47 Sankoff algorithm If we can compute these values for all nodes, we can also compute them for the bottom node in the tree. Simply choose the minimum of these values which is the desired total cost we seek, the minimum cost of evolution for this character. At the tips of the tree, the S(i) are easy to compute. The cost is 0 if the observed state is state i, and infinite otherwise. If we have observed an ambigous state, the cost is 0 for all states that it could be, and infinite for the rest. Now we just need an algorithm to calculate the S(i) for the immediate common ancestor of two nodes.

48 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik48 Sankoff algorithm Suppose that the two descendant nodes are called l and r (for left and right). For their immediate common ancestor, node a, we compute The smallest possible cost given that node a is in state i is the cost c ij of going from state i to state j in the left descendant lineage, plus the cost S l (j) of events further up in the subtree gien that node l is in state j. Select value of j that minimizes that sum. Same calculation for right descendant lineage sum of these two minima is the smallest possible cost for the subtree above node a, given that node a is in state i. Apply equation successively to each node in the tree, working downwards. Finally compute all S 0 (i) and use previous eq. to find minimum cost for whole tree.

49 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik49 Sankoff algorithm The array (6,6,7,8) at the bottom of the tree has a minimum value of 6 = minimum total cost of the tree for this site.

50 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik50 Distance matrix methods introduced by Cavalli-Sforza & Edwards (1967) and by Fitch & Margoliash (1967) general idea seems as if it would not work very well (Felsenstein): - calculate a measure of the distance between each pair of species - find a tree that predicts the observed set of distances as closely as possible. All information from higher-order combinations of character states is left out. But computer simulation studies show that the amount of lost information is remarkably small. Best way to think about distance matrix methods: consider distances as estimates of the branch length separating that pair of species.

51 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik51 Least square method - observed table (matrix) of distances D ij - any particular tree leads to a predicted set of distances d ij.

52 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik52 Least square method Measure of the discrepancy between the observed and expected distances: where the weights w ij can be differently defined: - w ij = 1 (Cavalli&Sforza, 1967) - w ij = 1/D ij 2 (Fitch&Margoliash, 1967) - w ij = 1/D ij (Beyer et al., 1974) Aim: Find tree topology and branch lengths that minimize Q. Equation above is quadratic in branch lengths. Take derivative with respect to branch lengths, set = 0, and solve system of linear equations. Solution will minimize Q. Doug Brutlags course

53 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik53 Least square method Number all branches of the tree and introduce an indicator variable x ijk : x ijk = 1 if branch k lies in the path from species i to species j x ijk = 0 otherwise. The expected distance between i and j will then be and For the case with w ij = 1 ij. Note: these are k equations for each of the k branches.

54 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik54 neighbor-joining method introduced by Saitou and Nei (1987) – algorithm works by clustering - does not assume a molecular clock but approximates the minimum evolution model. Minimum evolution model: among possible tree topologies, choose the one with minimal total branch length. Neighbor-joining, as the least-squares method, is guaranteed to recover the true tree if the distance matrix is an exact reflection of the tree.

55 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik55 neighbor-joining method (1) For each tip, compute (2) Choose the i and j for which D ij – u i – u j is smallest. (3) Join items i and j. Compute the branch length from i to the new node (v i ) and from j to the new node (v j ) as (4) Compute distance between the new node (ij) and each of the remaining tips as (5) Delete tips i and j from the tables and replace them by the new node, (ij), which is now treated as a tip. (6) If more than 2 nodes remain, go back to step (1). Otherwise, connect the two remaining nodes (e.g. l and m) by a branch of length D lm.

56 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik56 Methoden für Einzel-Gen-Phylogenien Wähle Menge von verwandten Sequenzen Berechne multiples Sequenz- alignment Gibt es starke Sequenz- ähnlichkeit? Maximale Parsimonie Methoden Ja Nein Gibt es deutlich erkenn- bare Sequenzähnlichkeit? Ja Distanz- methoden Nein Maximum likelihood Methoden Analysiere wie gut die Daten die Vorhersage unterstützen

57 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik57 zusätzliche Folien

58 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik58 GDE- The Genetic Data Environment (UNIX) CINEMA- Java applet available from: –http://www.biochem.ucl.ac.uk Seqapp/Seqpup- Mac/PC/UNIX available from: –http://iubio.bio.indiana.edu SeAl for Macintosh, available from: –http://evolve.zoo.ox.ac.uk/Se-Al/Se-Al.html BioEdit for PC, available from: –http://www.mbio.ncsu.edu/RNaseP/info/programs/BIOEDIT/bioedit.html Software für manuelle Alignments

59 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik59 Sequenz: MGGRSSCEDP GCPRDEERAP RMGCMKSKFL QVGGNTFSKT ETSASPHCPV YVPDPTSTIK PGPNSHNSNT PGIREAGSED IIVVALYDYE AIHHEDLSFQ KGDQMVVLEE SGEWWKARSL ATRKEGYIPS NYVARVDSLE TEEWFFKGIS RKDAERQLLA PGNMLGSFMI RDSETTKGSY SLSVRDYDPR QGDTVKHYKI RTLDNGGFYI SPRSTFSTLQ ELVDHYKKGN DGLCQKLSVP CMSSKPQKPW EKDAWEIPRE SLKLEKKLGA GQFGEVWMAT YNKHTKVAVK TMKPGSMSVE AFLAEANVMK TLQHDKLVKL HAVVTKEPIY IITEFMAKGS LLDFLKSDEG SKQPLPKLID FSAQIAEGMA FIEQRNYIHR DLRAANILVS ASLVCKIADF GLARVIEDNE YTAREGAKFP IKWTAPEAIN FGSFTIKSDV WSFGILLMEI VTYGRIPYPG MSNPEVIRAL ERGYRMPRPE NCPEELYNIM MRCWKNRPEE RPTFEYIQSV LDDFYTATES QYQQQP SMART ergibt: Beispiel: Src-Kinase HcK

60 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik60 Kinase-Einheit Beispiel: Src-Kinase HcK Protein Data Bank 1ATP

61 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik61 SH3 Domäne Src homology 3 (SH3) Domänen binden an Zielproteine mit Sequenzen, die Proline und hydrophobe Aminosäuren enthalten. Pro-enthaltende Polypeptide können an SH3 in zwei verschiedenen Orientierungen binden. SH3 Domänen sind kleine Proteinmodule von ungefähr 50 Residuen Länge. Man findet sie in vielen intrazellulären oder Membran-assoziierten Proteinen … Beispiel: Src-Kinase HcK CATH: 1abo

62 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik62 SH2 Domäne Die Src homology 2 (SH2) Domäne ist eine Proteindomäne mit etwa 100 Aminosäuren. SH2 Domänen funktionieren als Regelmodule von intrazellulären Signalkaskaden indem sie mit grosser Affinität an Phospho-Tyrosin enthaltende Peptide binden. SH2 Domänen findet man oft zusammen mit SH3 Domänen … Ihre Struktur ist alpha+beta … Beispiel: Src-Kinase HcK CATH: 1g83 1fbz1aot

63 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik63 Beispiel: Src-Kinase HcK

64 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik64 Was kann man mit modularem Denken erreichen?

65 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik65 Least square method D AB + D AC + D AD + D AE = 4v 1 + v 2 + v 3 + v 4 + v 5 + 2v 6 + 2v 7 D AB + D BC + D BD + D BE = v 1 + 4v 2 + v 3 + v 4 + v 5 + 2v 6 + 3v 7 D AC + D BC + D CD + D CE = v 1 + v 2 + 4v 3 + v 4 + v 5 + 3v 6 + 2v 7 D AD + D BD + D CD + D DE = v 1 + v 2 + v 3 + 4v 4 + v 5 + 2v 6 + 3v 7 D AE + D BE + D CE + D DE = v 1 + v 2 + v 3 + v 4 + 4v 5 + 3v 6 + 2v 7 D AC + D AE + D BC + D BE + D CD + D DE = 2v 1 + 2v 2 + 3v 3 + 2v 4 + 3v 5 + 6v 6 + 4v 7 D AB + D AD + D BC + D CD + D BE + D DE = 2v 1 + 3v 2 + 2v 3 + 3v 4 + 2v 5 + 4v 6 + 6v 7 Stack up the ( = 10) D ij, in alphabetical order, into a vector and the coefficients x ijk are arranged in a matrix X with each row corresponding to the D ij in the row of d and containing a 1 if branch k occurs on the path between species i and j.

66 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik66 Least square method If we also stack up the 7 v i into a vector v, the previous set of linear equations can be compactly expressed as: Multiplied from the left by the inverse of X T X one can solve for the least squares branch lengths This is a standard method of expressing least squares problems in matrix notation and solving them. check for example :-)

67 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik67 Least square method When we have weighted least squares, with a diagonal matrix of weights in the same order as the D ij : then the least square equations can be written and their solution

68 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik68 Finding the least squares tree topology Now that we are able to assign branch lengths to each tree topology. we need to search among tree topologies. This can be done by the same methods of heuristic search that were presented for the Maximum Parsimony method. Note: no-one has sofar presented a branch-and-bound method for finding the least squares tree exactly. Day (1986) has shown that this problem is NP-complete. The search is not only among tree topologies, but also among branch lengths.

69 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik69 Methods of rooting the tree There are many rooted trees, one for each branch of this unrooted tree, and all have the same number of changes of state. The number of changes of state only depends on the unrooted tree, and not at all on where the tree is then rooted. Biologists want to think of trees as rooted need method to place the root in an otherwise unrooted tree. (1) Outgroup criterion (2) Use a molecular clock.

70 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik70 Outgroup criterion Assumes that we know the answer in advance. Suppose that we have a number of great apes, plus a single old-world monkey. Suppose that we know that the great apes are a monophyletic group. If we infer a tree of these species, we know that the root must be placed on the lineage that connects the old-world monkey (outgroup) to the great apes (ingroup).

71 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik71 Molecular clock If an equal amount of changes were observed on all lineages, there should be a point on the tree that has equal amounts of change (branch lengths) from there to all tips. With a molecular clock, it is only the expected amounts of change that are equal. The observed amounts may not be. using various methods find a root that makes the amounts of change approximately equal on all lineages.

72 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik72 Branch lengths Having found an unrooted tree, locate the changes on it and find out how many occur in each of the branches. The location of the changes can be ambiguous. average over all possible reconstructions of each character for which there is ambiguity in the unrooted tree. Fractional numbers in some branches of left tree add up to (integer) number of changes (right)

73 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik73 Open questions * Particularly for larger data sets, need to know how to count number of changes of state by use of an algorithm. * need to know algorithm for reconstructing states at interior nodes of the tree. * need to know how to search among all possible trees for the most parsimonious ones, and how to infer branch lengths. * sofar only considered simple model of 0/1 characters. DNA sequences have 4 states, protein sequences 20 states. * Justification: is it reasonable to use the parsimony criterion? If so, what does it implicitly assume about the biology? * What is the statistical status of finding the most parsimonious tree? Can we make statements how well-supported it is compared to other trees?

74 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik74 dynamische Programmierung mit MSA Programm Links: Baum für 5 Sequenzen ohne Paarung von Sequenzen. Neighbour-joining Methode: berechne Summe aller Kantenlängen S = a + b + c + d + e (Kantenlängen sind bekannt) In diesem Fall seien sich A und B am nächsten. Konstruiere daher den Baum rechts. Generell: Verbinde die Sequenzpaare mit den kürzesten Abständen … Man erhält den Baum mit der kleinsten Summe der Kantenlängen. Konstruiere anhand phylogenetischem Baum ein versuchsweises Multiples Sequenz Alignment.

75 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik75 Dieses Alignment dient dazu, den möglichen Raum inmitten des Würfels einzugrenzen, in dem das beste MSA zu finden sein sollte. Grosse Rechenersparnis! dynamische Programmierung mit MSA Programm

76 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik76 limitation of distance methods Distance matrix methods are the easiest phylogeny method to program, and they are very fast. Distance methods have problems when the evolutionary rates vary largely. One can correct for this in distance methods as well as in likelihood methods. When variation of rates is large, these corrections become important. In likelihood methods, the correction can use information from changes in one part of the tree to inform the correction in others. Once a particular part of the molecule is seen to change rapidly in the primates, this will affect the interpretation of that part of the molecule among the rodents as well. But a distance matrix method is inherently incapable of propagating the information in this way. Once one is looking at changes within rodents, it will forget where changes were seen among primates.

77 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik77 Evaluating a particular tree Figure right shows another tree also requiring 8 changes. These two most parsimonious trees are the same tree when the roots of the tree are removed.

78 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik78 Die am meisten divergenten Sequenzen (also am stärksten von allen anderen Sequenzen verschiedenen) sind gewönlich am schwierigsten zu alignieren Es ist manchmal besser, ihr Alignment auf einen späteren Zeitpunkt zu verschieben (nachdem die einfacheren Sequenzen aligniert wurden) Man kann dazu einen Cutoff wählen (der Default liegt bei 40% Identität). Divergente Sequenzen

79 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik79 Fitch algorithm intended to count the number of changes in a bifurcating tree with nucleotide sequence data, in which any one of the 4 bases (A, C, G, T) can change to any other. At the particular site, we have observed the bases C, A, C, A and G in the 5 species. Give them in the order in which they appear in the tree, left to right.

80 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik80 Fitch algorithm For the left two, at the node that is their immediate common ancestor, attempt to construct the intersection of the two sets. But as {C} {A} = instead construct the union {C} {A} = {AC} and count 1 change of state. For the rightmost pair of species, assign common ancestor as {AG}, since {A} {G} = and count another change of state..... proceed to bottom Total number of changes = 3. Algorithm works on arbitrarily large trees.

81 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik81 Complexity of Fitch algorithm Fitch algorithm can be carried out in a number of operations that is proportional to the number of species (tips) on the tree. Dont we need to multiply this by the number of sites n ? Any site that is invariant (which has the same base in all species, e.g. AAAAA) can be dropped. Other sites with a single variant base (e.g. ATAAA) will only require a single change of state on all trees. These too can be dropped. For sites with the same pattern (e.g. CACAG) that we have already seen, simply use number of changes previously computed. Pattern following same symmetry (e.g. TCTCA = CACAG) need same number of changes numerical effort rises slower than linearly with the number of sites.

82 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik82 Sankoff algorithm Fitch algorithm is very effective – but we cant understand why it works. Sankoff algorithm: more complex, but its structure is more apparent. Assume that we have a table of the cost of changes c ij between each character state i and each other state j. Compute the total cost of the most parsimonious combinations of events by computing it for each character. For a given character, compute for each node k in the tree a quantity S k (i). This is interpreted as the minimal cost, given that node k is assigned state i, of all the events upwards from node k in the tree.

83 3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik83 Least square method Number species in alphabetical order. The expected distance between species A and D d 14 = v 1 + v 7 + v 4 The expected distance between species B and E d 25 = v 5 + v 6 + v 7 + v 2. v1v1 v2v2 v3v3 v4v4 v5v5 v6v6 v7v7


Herunterladen ppt "3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik1 V3 - Multiples Sequenz Alignment und Phylogenie Literatur: Kapitel 4 in Buch von David Mount."

Ähnliche Präsentationen


Google-Anzeigen