Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Der Bauplan des Menschen Sequencing by Hybridization SBH Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002.

Ähnliche Präsentationen


Präsentation zum Thema: "Der Bauplan des Menschen Sequencing by Hybridization SBH Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002."—  Präsentation transkript:

1 Der Bauplan des Menschen Sequencing by Hybridization SBH Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002

2 Der Bauplan des Menschen Zwei komplementäre DNA-Einzelstränge können durch Wasserstoffbrückenbildung eine Doppel- helix bilden. Diesen Vorgang nennt man Hybridisierung. Adenin Thymin Guanin Cytosin Durch Erwärmung auf Temperaturen über 80 Grad C oder durch Zugabe von organischen Lösungs- mitteln (wie Formamid) können Doppelstränge in zwei Einzelstränge getrennt werden. Diesen Vorgang nennt man Denaturierung.

3 Der Bauplan des Menschen Bestimmte DNA-Muster in Chromosomen oder mRNA kann man wie folgt nachweisen: (1) Wohldefinierte DNA-Moleküle (Folgen von Basen) werden mit einer Oberfläche verlinkt: (2) Die DNA-Moleküle, in denen man diese Basenfolge nachweisen möchte, werden mit einem Fluoreszenzfarbstoff markiert, der durch eine geeignete Lichtquelle zur Fluoreszenz angeregt wird. (3) Durch Hybridisierung werden die Moleküle mit komplementären Strängen gebunden.

4 Der Bauplan des Menschen Durch den Einsatz von photolithographischen Verfahren kann man zweidimensionale DNA-Chips erzeugen, die tausende von verschiedenen DNA-Sequenzen an wohldefinierten Orten auf dem Chip tragen. Zum Beispiel kann man Felder erzeugen, die alle möglichen Basenfolgen der Länge l (für kleines l) auf der Oberfläche präsentieren. AAACAGAT CCCGCTCA GGGCGTGA TTTCTGTA

5 Der Bauplan des Menschen Ein Graph besteht aus Knoten und Kanten. Hamburg Berlin Dresden Nürnberg München Stuttgart Saarbrücken Köln Frankfurt Mannheim 300 km 200 km 150 km 250 km 50 km 100 km 450 km 400 km 300 km 200 km G = (V,E), wobei V die Menge der Knoten (vertices) und E die Menge der Kanten E (edges) ist. Der Grad eines Knoten ist gleich der Zahl der Kanten, die im Knoten enden.

6 Der Bauplan des Menschen Ein Graph besteht aus Knoten und Kanten. G = (V,E), wobei V die Menge der Knoten (vertices) und E die Menge der Kanten E (edges) ist. Der Grad eines Knoten ist gleich der Zahl der Kanten, die im Knoten enden. v1v1 v3v3 v2v2 v4v4 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 e 1 =(v 1,v 2 ) e 2 =(v 1,v 3 ) e 5 =(v 3,v 5 ) e 4 =(v 3,v 4 ) e 7 =(v 4,v 7 ) e 6 =(v 4,v 5 ) e 12 =(v 7,v 8 ) e 3 =(v 2,v 5 ) e 9 =(v 5,v 7 ) e 13 =(v 8,v 9 ) e 10 =(v 6,v 9 ) e 8 =(v 5,v 6 ) e 11 =(v 6,v 10 )

7 Der Bauplan des Menschen Ein Graph besteht aus Knoten und Kanten. G = (V,E), wobei V die Menge der Knoten (vertices) und E die Menge der Kanten E (edges) ist. Der Grad eines Knoten ist gleich der Zahl der Kanten, die im Knoten enden. v1v1 v3v3 v2v2 v4v4 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 e 1 =(v 1,v 2 ) e 2 =(v 1,v 3 ) e 5 =(v 3,v 5 ) e 4 =(v 3,v 4 ) e 7 =(v 4,v 7 ) e 6 =(v 4,v 5 ) e 12 =(v 7,v 8 ) e 3 =(v 2,v 5 ) e 9 =(v 5,v 7 ) e 13 =(v 8,v 9 ) e 10 =(v 6,v 9 ) e 8 =(v 5,v 6 ) e 11 =(v 6,v 10 ) Ein Pfad von Knoten v i nach Knoten v j ist eine Folge von Knoten v i, v ?,...., v j, wobei jedes Paar von aufeinander folgen- den Knoten v k, v l durch eine Kante (v k, v l ) verbunden ist. Ein Pfad wird als einfach bezeich- net, wenn jeder Knoten in der Pfadbeschreibung genau einmal vorkommt.

8 Der Bauplan des Menschen Ein Graph besteht aus Knoten und Kanten. G = (V,E), wobei V die Menge der Knoten (vertices) und E die Menge der Kanten E (edges) ist. Der Grad eines Knoten ist gleich der Zahl der Kanten, die im Knoten enden. v1v1 v3v3 v2v2 v4v4 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 e 1 =(v 1,v 2 ) e 2 =(v 1,v 3 ) e 5 =(v 3,v 5 ) e 4 =(v 3,v 4 ) e 7 =(v 4,v 7 ) e 6 =(v 4,v 5 ) e 12 =(v 7,v 8 ) e 3 =(v 2,v 5 ) e 9 =(v 5,v 7 ) e 13 =(v 8,v 9 ) e 10 =(v 6,v 9 ) e 8 =(v 5,v 6 ) e 11 =(v 6,v 10 ) Ein Pfad von Knoten v i nach Knoten v j ist eine Folge von Knoten v i, v ?,...., v j, wobei jedes Paar von aufeinander folgen- den Knoten v k, v l durch eine Kante (v k, v l ) verbunden ist. Ein Pfad wird als einfach bezeich- net, wenn jeder Knoten in der Pfadbeschreibung genau einmal vorkommt. Ein Pfad wird als Circuit bezeich- net, wenn der erste und der letzte Knoten des Pfades identisch sind. v 3 v 5 v 6 v 9 v 8 v 7 v 5 v 3

9 Der Bauplan des Menschen Ein Graph besteht aus Knoten und Kanten. G = (V,E), wobei V die Menge der Knoten (vertices) und E die Menge der Kanten E (edges) ist. Der Grad eines Knoten ist gleich der Zahl der Kanten, die im Knoten enden. v1v1 v3v3 v2v2 v4v4 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 e 1 =(v 1,v 2 ) e 2 =(v 1,v 3 ) e 5 =(v 3,v 5 ) e 4 =(v 3,v 4 ) e 7 =(v 4,v 7 ) e 6 =(v 4,v 5 ) e 12 =(v 7,v 8 ) e 3 =(v 2,v 5 ) e 9 =(v 5,v 7 ) e 13 =(v 8,v 9 ) e 10 =(v 6,v 9 ) e 8 =(v 5,v 6 ) e 11 =(v 6,v 10 ) Ein Pfad von Knoten v i nach Knoten v j ist eine Folge von Knoten v i, v ?,...., v j, wobei jedes Paar von aufeinander folgen- den Knoten v k, v l durch eine Kante (v k, v l ) verbunden ist. Ein Pfad wird als einfach bezeich- net, wenn jeder Knoten in der Pfadbeschreibung genau einmal vorkommt. Ein Pfad wird als Circuit bezeich- net, wenn der erste und der letzte Knoten des Pfades identisch sind. v 3 v 5 v 6 v 9 v 8 v 7 v 5 v 3 Ein Circuit (Rundgang) wird als einfach (oder als Kreis) bezeich- net, falls alle Knoten außer dem ersten und dem letzten nur einmal auftreten: v 3 v 5 v 6 v 9 v 8 v 7 v 4 v 3

10 Der Bauplan des Menschen Ein bipartiter Graph besteht aus zwei disjunkten Mengen von Knoten (rot, blau). MitarbeiterAufgaben Es gibt nur Kanten zwischen einem roten und einem blauen Knoten. Haben die Kanten eine Richtung, so spricht man von einem gerichteten Graphen (andernfalls von einem ungerichteten Graphen).

11 Der Bauplan des Menschen Existiert zwischen jedem Knotenpaar eine Kante, so spricht man von einem vollständigen Graphen.

12 Der Bauplan des Menschen Der Schweitzer Mathematiker Leonard Euler hat sich 1736 mit der folgenden Fragestellung, dem sogenannten Königsberger-Brückenproblem, beschäftigt: A B CDPregel Ist es möglich, von irgendeinem Punkt in der Stadt loszulaufen und zu diesem Punkt wieder zurückzukehren und dabei genau einmal über jede der sieben Brücken zu wandern.

13 Der Bauplan des Menschen Der Schweitzer Mathematiker Leonard Euler hat sich 1736 mit der folgenden Fragestellung, dem sogenannten Königsberger-Brückenproblem, beschäftigt: A B CDPregel Ist es möglich, von irgendeinem Punkt in der Stadt loszulaufen und zu diesem Punkt wieder zurückzukehren und dabei genau einmal über jede der sieben Brücken zu wandern.

14 Der Bauplan des Menschen Der Schweitzer Mathematiker Leonard Euler hat sich 1736 mit der folgenden Fragestellung, dem sogenannten Königsberger-Brückenproblem, beschäftigt: A B CD = Gibt es einen Circuit in diesem Graphen, der jede Kante nur einmal begeht (verwendet)? Multi-Graph: Mehrere Kanten zwischen zwei Knoten sind erlaubt. Ist es möglich, von irgendeinem Punkt in der Stadt loszulaufen und zu diesem Punkt wieder zurückzukehren und dabei genau einmal über jede der sieben Brücken zu wandern. Nein! Warum kann es keinen solchen Circuit geben?

15 Der Bauplan des Menschen Der Schweitzer Mathematiker Leonard Euler hat sich 1736 mit der folgenden Fragestellung, dem sogenannten Königsberger-Brückenproblem, beschäftigt: A B CD Multi-Graph: Mehrere Kanten zwischen zwei Knoten sind erlaubt. Nein! Warum kann es keinen solchen Circuit geben? Antwort: Es gibt Knoten mit ungeradem Grad (3 und 5). Ein solcher Circuit kann aber nur existieren, wenn alle Knoten geraden Grad haben und der Graph zusammenhängend ist. Ein Graph heißt zusammenhängend (connected), wenn man von jedem Knoten aus jeden anderen Knoten über einen Pfad erreichen kann.

16 Der Bauplan des Menschen Definition: Ein Graph heißt Euler-Graph, wenn jeder Knoten einen geraden Grad hat und der Graph zusammenhängend ist. Satz: Ein Graph besitzt genau dann einen Euler-Circuit, wenn der Graph ein Euler-Graph ist. A B CD EF G H I Wir beweisen die schwierigere Richtung (Euler-Graph => Euler Circuit) mittels vollständiger Induktion über die Anzahl m der Kanten: Induktionsstart: m = 2 (trivial). Induktionsannahme: Jeder zusammenhängende Graph mit weniger als m Kanten, dessen Knoten alle geraden Grad haben, besitzt eine Euler-Tour. Sei G=(V,E) ein Euler-Graph mit m Kanten. 1. Bestimme in G einen Kreis.Zum Beispiel K=ACBDA. 2. Lösche die Kanten von K.

17 Der Bauplan des Menschen Definition: Ein Graph heißt Euler-Graph, wenn jeder Knoten einen geraden Grad hat und der Graph zusammenhängend ist. Satz: Ein Graph besitzt genau dann einen Euler-Circuit, wenn der Graph ein Euler-Graph ist. A B CD EF G H I Wir beweisen die schwierigere Richtung (Euler-Graph => Euler Circuit) mittels vollständiger Induktion über die Anzahl m der Kanten: Induktionsstart: m = 2 (trivial). Induktionsannahme: Jeder zusammenhängende Graph mit weniger als m Kanten, dessen Knoten alle geraden Grad haben, besitzt eine Euler-Tour. Sei G=(V,E) ein Euler-Graph mit m Kanten. 1. Bestimme in G einen Kreis.Zum Beispiel K=ACBDA. 2. Lösche die Kanten von K.Den neuen Graphen nennen wir G. Alle Knoten von G haben geraden Grad. Aber der Graph G kann aus mehreren Zusammenhangskom- ponenten (ZKs) mit weniger als m Kanten bestehen: Z(1) = {A}, Z(2) = {D}, Z(3) = {H,I,C}, Z(4)={B,E,G,F} 3. Bestimme die Zusammenhangskomponenten von G 4. Starte für alle Zusammenhangskomponenten diesen (rekursiven) Algorithmus zur Berechnung eines Euler-Circuits: Circ(Z(3)) = CIHC Circ(Z(4)) = BEGFB 5. Mische den Kreis K und die Euler-Circuits der ZKs: Circuit = ACIHCBEGFBDA

18 Der Bauplan des Menschen v1v1 v3v3 v2v2 v4v4 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 Zusammenhangskomponenten: Gegeben ein ungerichteter Graph G=(V,E) und ein Knoten v. ZK (G,v): 1. Markiere v; 2. Für alle Kanten (v,w) führe die folgenden Operationen aus: a.Falls w nicht markiert ist, dann starte ZK(G,w); Bestimme die Zusammenhangskomponente, zu der v gehört. Die Laufzeit von ZK(G,v) ist O(#Kanten in ZK(v)).

19 Der Bauplan des Menschen v4v4 v1v1 v3v3 v2v2 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 Zusammenhangskomponenten: Gegeben ein ungerichteter Graph G=(V,E) und ein Knoten v. ZK (G,v, NummerDerZK): 1. Markiere v mit NummerDerZK; 2. Für alle Kanten (v,w) führe die folgenden Operationen aus: a.Falls w nicht markiert ist, dann starte ZK(G,w,NummerDerZK); Bestimme alle Zusammenhangskomponenten von G. Die Laufzeit von ZK(G,v,..) ist O(#Kanten in ZK(v)) Zusammenhangskomponenten(G):NummerDerZK = 0; Solange es in G einen unmarkierten Knoten v gibt: NummerDerZK++; Die Laufzeit des obigen Algorithmus ist O(|V|+|E|).

20 Der Bauplan des Menschen v4v4 v1v1 v3v3 v2v2 v5v5 v6v6 v7v7 v8v8 v9v9 v 10 Zusammenhangskomponenten: Gegeben ein ungerichteter Graph G=(V,E) und ein Knoten v. ZK (G,v, NummerDerZK): 1. Markiere v mit NummerDerZK; 2. Für alle Kanten (v,w) führe die folgenden Operationen aus: a.Falls w nicht markiert ist, dann starte ZK(G,w,NummerDerZK); Bestimme alle Zusammenhangskomponenten von G. Die Laufzeit von ZK(G,v,..) ist O(#Kanten in ZK(v)). Zusammenhangskomponenten(G):NummerDerZK = 0; Solange es in G einen unmarkierten Knoten v gibt: NummerDerZK++; Die Laufzeit des obigen Algorithmus ist O(|V|+|E|)

21 Der Bauplan des Menschen Definition: Ein gerichteter Graph heißt Euler-Graph, wenn der Graph zusammenhängend und balanciert ist. Satz: Ein Graph besitzt genau dann einen Euler-Circuit, wenn der Graph ein Euler-Graph ist. Definition: Ein Knoten v eines gerichteten Graphen ist balanciert, wenn die Zahl der in v endenden Kanten gleich der Zahl der in v startenden Kanten ist. Definition: Ein gerichteter Graph ist balanciert, wenn jeder Knoten des Graphen balanciert ist. Beweis: Analog zum konstruktiven Beweis im Falle des ungerichteten Graphen. Definition: Ein Graph besitzt einen Euler-Pfad, wenn es einen Pfad im Graphen gibt, der jede Kante genau einmal verwendet bzw. genau einmal über diese Kante geht. Definition: Ein Knoten v eines gerichteten Graphen ist semi-balanciert falls | indegree(v) – outdegree(v) | = 1.

22 Der Bauplan des Menschen Definition: Ein Graph besitzt einen Euler-Pfad, wenn es einen Pfad im Graphen gibt, der jede Kante genau einmal verwendet bzw. genau einmal über diese Kante geht. Definition: Ein Knoten v eines gerichteten Graphen ist semi-balanciert falls | indegree(v) – outdegree(v) | = 1. Satz: Ein zusammenhängender Graph besitzt genau dann einen Euler-Pfad, wenn er höchstens zwei semi-balancierte Knoten besitzt und alle anderen balanciert sind. Beweis: Analog zum Beweis der Existenz eine Euler-Circuit (mit mehr Fallunterscheidungen).

23 Der Bauplan des Menschen Gegeben ein unbekanntes DNA-Molekül, d.h., die Basenfolge ist unbekannt. Man möchte die Basenfolge lesen (bestimmen). ????????? ATGCAGGTCC TACGTCCAGG Gegeben sei ein DNA-Array mit allen möglichen l-Tupeln (alle Basenfolgen der Länge l). AA AT AG AC TA TT TG TC GA GT GG GC CA CT CG CC A T C G Kopien des mit Fluoreszenzfarbstoff markierten DNA- Moleküls werden in Lösung befindlich auf das Array aufgetragen. Die Kopien des Moleküls binden durch Hybridisierung an die Stellen des Arrays, wo komplementäre l-Tuple vorhanden sind. ATG AGG TGC TCC GTC GGT GCA CAG Lokalisiere die l-Tuple mittels spektroskopischer Detek- toren. Rekonstruiere die Sequenz anhand ihrer l-Tuple mit Hilfe von kombinatorischen Algorithmen. Definition: l-Spektrum einer Sequenz = Menge aller l-Tuple, die in der Sequenz auftreten.

24 Der Bauplan des Menschen Rekonstruiere die Sequenz anhand ihres l-Spektrums mit Hilfe von kombinatorischen Algorithmen. Shortest-Superstring-Problem: Gegeben eine Menge von Strings { S 1,..., S m }. Man berechne einen kürzesten (Super) String S, der alle S i als Teilstrings enthält. Das Shortest-Superstring-Problem ist NP-vollständig. Es kann als eine Variante des Traveling-Salesman Problem formuliert werden. Jeder String S i wird durch einen Knoten eines gerichteten vollständigen Graphen G=(V,E) repräsentiert. ATG TGCGCA CAG AGG GGTGTC TCC Die Kante von S i nach S j erhält ein Gewicht von – overlap(S i, S j ), wobei der Overlap die Länge des maximalen Präfixes von S j ist, das auch Suffix von S i ist Hamiltonian Path: Berechne den kürzesten Pfad, der jeden Knoten genau einmal besucht.

25 Der Bauplan des Menschen Rekonstruiere die Sequenz anhand ihres l-Spektrums mit Hilfe von kombinatorischen Algorithmen. l-Spektrum S = { ATG, TGC, GCA, CAG, AGG, GGT, GTC, TCC } ATTGGCAGGGGTTCCA Euler-Pfad-Ansatz: Wir betrachten alle (l-1)-Tuple. Für jedes l-Tuple im l-Spektrum führen wir eine Kante in den Graph ein. Die Kante führt vom Knoten mit den ersten (l-1) Buchstaben des l-Tuple zum Knoten mit den letzten (l-1) Buchstaben des l-Tuple. Berechne den (einen) Euler-Pfad des Graphen.. Ein Graph kann mehrere (viele) Euler-Pfade besitzen. l-Spektrum S = { ATG, TGG, GGC, GCG, CGT, GTG, TGC, GCA } ATTGGC GG GTCG CA

26 Der Bauplan des Menschen Wie kann man testen, ob ein Euler-Graph einen eindeutig bestimmten Euler-Circuit besitzt? Man zerlege den Euler-Graph in einfache Kreise. A B CD EF G H I Einfach bedeutet, dass jede Kante zu genau einem Kreis gehört. K1K1 K2K2 K3K3 Der Schnittgraph G= (V, E) dieser Kreise ist wie folgt definiert: Die Kreise des Graphen sind die Knoten V = { K 1,..., K n }. Für jeden Knoten, den K i und K j gemeinsam haben, wird eine Kante zwischen K i und K j eingeführt. Satz: Ein Euler-Graph hat genau dann einen eindeutig bestimmten Euler-Circuit, wenn der Schnittgraph ein Baum ist.

27 Der Bauplan des Menschen Fehler bei der Hybridisierung oder bei der Auswertung des DNA-Arrays? Eliminieren den Euler-Pfad. Repeats länger als (l-1) Buchstaben. Eliminieren den Euler-Pfad. ATCTG.....TTCTA AT TG TA CTTC TT Mit DNA-Arrays (SBH) kann man nur sehr kurze DNA-Moleküle sequenzieren. Man hat auch nur sehr kurze l-Tuple (l=8) zur Verfügung.

28 Der Bauplan des Menschen Fragment-Sequence-Assembly-Problem: (5) Assemblieren ATGCGGTTGCTACGT ATCGGTGACCA ATTCATGCGGTTGC CGTCGTATCG GACCACGGTT TCATGCGG ACGTCGT TCGGTGACCACGGTT ATTCATG GGTTGCTAC CGTATCG ACCACGG ATTCATGCGGTTGCTACGTCGTATCGGTGACCACGGTT ATGGCCTCGTCAATGCATG CCGGTGCATGCATGGCCTCGTCAA Man suche alle Paare von Text- fragmenten, die sich überlappen, d.h., das Ende des einen Frag- ments ist identisch oder ähnelt dem Anfang des anderen Frag- ments oder umgekehrt. Mit Hilfe dieser Überlappungs- informationen versucht man das riesige Textpuzzle zusammen- zusetzen und den Originaltext zu rekonstruieren. Gegeben eine große Zahl (10 x Überdeckung) von sequenzierten Fragmenten der Länge ca. 500 bp.

29 Der Bauplan des Menschen Fragment-Sequence-Assembly-Problem: (5) Assemblieren Gegeben eine große Zahl (10 x Überdeckung) von sequenzierten Fragmenten der Länge ca. 500 bp. Idury & Waterman (1995): Idee: SBH Nachahmen. Zerlege jedes Fragment der Länge n in (n-l+1) l-Tuple (z.B. l = 20). AATGCCCGTTGCTACTGCGACGTCACGTGCATGCG AATGCCCGTTGCTACTGCG ATGCCCGTTGCTACTGCGA TGCCCGTTGCTACTGCGAC GCCCGTTGCTACTGCGACG CCCGTTGCTACTGCGACGT CCGTTGCTACTGCGACGTC usw. Generiere Graph wie bei SBH mit den entsprechenden (l-1) Tuples. Berechne den (einen) Euler-Pfad.

30 Der Bauplan des Menschen Fragment-Sequence-Assembly-Problem: (5) Assemblieren Gegeben eine große Zahl (10 x Überdeckung) von sequenzierten Fragmenten der Länge ca. 500 bp. Idury & Waterman (1995): Idee: SBH Nachahmen. Zerlege jedes Fragment der Länge n in (n-l+1) l-Tuple (z.B. l = 20). Generiere Graph wie bei SBH mit den entsprechenden (l-1) Tuples. Berechne den (einen) Euler-Pfad. Dieser Ansatz funktioniert, falls1. perfekte Daten (keine Fehler) vorliegen. 2. keine Repeats, die länger als (l-2) sind, vorkommen.

31 Der Bauplan des Menschen Pevzner&Tang&Waterman (2001): Sei S = { s 1,..., s n } die Menge der Fragmente. Sei S l-1 das (l-1)-Spektrum von S. Sei U eine obere Schranke für die Zahl der Fehler in jedem der Fragmente. Idee: Man minimiere die Größe |S l-1 | des (l-1)-Spektrums, indem man in jedem Fragment maximal U Korrekturen durchführt. Jeder Fehler generiert (l-1) fehlerhafte Tuple (< (l-1) falls am Rand eines Fragments). Brute-Force-Ansatz (Greedy): Für alle Fragmente: 1. ZahlDerKorrekturen = 0; 2. Solange (ZahlDerKorrekturen < U) a. Bestimme Korrektur, so dass |S l-1 | um (l-1) verkleinert wird. b. ZahlDerKorrekturen++; Tests von Pevzner&Tang&Waterman (2001) zeigen, dass die Zahl der Sequenzierungsfehler um 86.5 % reduziert werden.

32 Der Bauplan des Menschen Pevzner&Tang&Waterman (2001): Sei S = { s 1,..., s n } die Menge der Fragmente. Sei S l-1 das (l-1)-Spektrum von S. Ein (l-1) Tuple heißt solide, wenn es in mehr als M Fragmenten vorkommt. Beispiel: M = 5 (2) für 10 x Überdeckung. Zwei (l-1) Tuple heißen Nachbarn, wenn sie eine Mutation voneinander entfernt sind. Ein (l-1) Tuple t heißen Orphan (Waise), wenn 1. es nicht solide ist, d.h., m(t) M, 2. es genau einen Nachbarn t hat und 3. m(t) m(t). Für alle Fragmente: 1. ZahlDerKorrekturen = 0; 2. Solange (ZahlDerKorrekturen < U) a. Suche Orphan t, so dass ERSETZE(t durch t) |S l-1 | um (l-1) verkleinert. b. ZahlDerKorrekturen++; 97.7 % Fehlerreduzierung

33 Der Bauplan des Menschen Pevzner&Tang&Waterman (2001): Sei S = { s 1,..., s n } die Menge der Fragmente. Sei S l-1 das (l-1)-Spektrum von S. G(S l-1 ) = (V,E) sei der sogenannte de Bruijn Graph mit V = (l-1) Spektrum von S. E = {(v i, v j ) | v i und v j repräsentieren benachbarte (l-1) Tuples } Genauer: Jede Kante in G entspricht einem l-Tuple t von S. v i repräsentiert die ersten (l-1) Buchstaben von t. v j repräsentiert die letzten (l-1) Buchstaben von t. Bemerkung: Der de Bruijn Graph besitzt einen (eindeutigen) Euler-Pfad, wenn 1. keine Sequenzierungsfehler in den s i vorliegen, 2. keine Repeats, die länger als (l-2) sind, in den s i vorkommen und 3. der Graph zusammenhängend ist (keine Überdeckungslücken vorkommen). Contig 1 Contig 2

34 Der Bauplan des Menschen Pevzner&Tang&Waterman (2001): Ein Pfad v 1,...., v n in dem de Bruijn Graph heißt Repeat, falls a. indegree(v 1 )> 1 b. outdegree(v n )> 1 c. indegree(v i ) = outdegree(v i ) = 1 für i {2,..., n} v2v2 v1v1 vnvn v n-1 Ein Euler-Pfad besucht diesen Teilpfad mehrmals (Multiplizität der Kanten ?, Multigraph?). Die Kanten, die in v 1 enden, heißen Eingänge. Die Kanten, die in v n starten, heißen Ausgänge. Jedes Vorkommen eines Repeats besitzt einen Eingang und einen Ausgang. Die Information, welcher Ausgang mit welchem Eingang gekoppelt ist (zu einem Vorkommen eines Repeats gehört), geht im de Bruijn Graph verloren.

35 Der Bauplan des Menschen Pevzner&Tang&Waterman (2001): Euler-Superpfad-Problem: Gegeben ein de Bruijn Graph G und einem Menge von Pfaden P v2v2 v1v1 vnvn v n-1 (die Pfade, die den Fragmenten entsprechen). pipi pjpj Finde einen Euler-Pfad in diesem Graph, der alle Pfade von P als Teilpfade enthält. Lösungsansatz: Führe eine Reihe von Äquivalenztransformationen aus, (G,P)(G 1,P 1 )(G k,P k ) so dass es eins-zu-eins Beziehung zwischen den Euler-Superpfaden in den G i gibt.

36 Der Bauplan des Menschen Pevzner&Tang&Waterman (2001): Lösungsansatz: Führe eine Reihe von Äquivalenztransformationen aus, (G,P)(G 1,P 1 )(G k,P k ) so dass es eins-zu-eins Beziehung zwischen den Euler-Superpfaden in den G i gibt. Ziel: Ein Graph G k, in dem jeder Pfad aus P k aus einer Kante besteht, d.h., das Euler-Pfad-Problem in G k liefert dann eine Lösung des Superpfad-Problems in G. Transformation bei einfachen Kanten (keine multiplen Kanten). P y-> = {p| p startet mit y} P ->x = {p| p endet mit x} P x,y = {p| p enthält x und y} v in x=(v in,v mid ) v mid v out y=(v mid,v out ) vor Transformation

37 Der Bauplan des Menschen P y-> = {p| p startet mit y} P ->x = {p| p endet mit x} P x,y = {p| p enthält x und y} v in x=(v in,v mid ) v mid v out y=(v mid,v out ) vor Transformation v in v mid v out z nach Transformation 1. Ersetze x und y in allen Pfaden in P x,y durch z. 2. Ersetze y durch z in allen Pfaden in P y-> 3. Ersetze x durch z in allen Pfaden in P ->x

38 Der Bauplan des Menschen P ->x = {p| p endet mit x} Beispiel mit mutiplen Kanten: vor Transformation v in x=(v in,v mid ) v mid v out1 y 1 =(v mid,v out1 ) v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Beispiel mit multiplen Kanten: nach Transformation P ->x v in x=(v in,v mid ) v mid v out1 z v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Problem: Wie enden die Pfade in P ->x ?

39 Der Bauplan des Menschen Beispiel mit multiplen Kanten: nach Transformation P ->x v in x=(v in,v mid ) v mid v out1 z v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Problem: Wie enden die Pfade in P ->x ? Für jeden Pfad p P ->x muß entschieden werden, ob (1) x durch z ersetzt wird. (2) er (weiter) in x endet (Richtung y 2 ). Definition: Zwei Pfade heißen konsistent, wenn ihre Vereinigung wieder ein Pfad ist. Ein Pfad p ist konsistent mit einer Menge von Pfaden P, wenn p zu jedem Pfad in P konsistent ist.

40 Der Bauplan des Menschen Beispiel mit multiplen Kanten: nach Transformation P ->x v in x=(v in,v mid ) v mid v out1 z v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Problem: Wie enden die Pfade in P ->x ? Sei p P ->x : Fall 1: p ist konsistent mit genau einer der Pfadmengen P x,y1 und P x,y2 v in x=(v in,v mid ) v mid v out1 v out2 P x,y1 P x,y2 p (1) x wird durch z in p ersetzt.

41 Der Bauplan des Menschen Beispiel mit multiplen Kanten: nach Transformation P ->x v in x=(v in,v mid ) v mid v out1 z v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Problem: Wie enden die Pfade in P ->x ? Sei p P ->x : Fall 1: p ist konsistent mit genau einer der Pfadmengen P x,y1 und P x,y2 v in x=(v in,v mid ) v mid v out1 v out2 P x,y1 P x,y2 p (2) p endet (weiter) in x.

42 Der Bauplan des Menschen Beispiel mit multiplen Kanten: nach Transformation P ->x v in x=(v in,v mid ) v mid v out1 z v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Problem: Wie enden die Pfade in P ->x ? Es existiert keine Lösung des Superpfad-Problem Sei p P ->x : Fall 2: p ist inkonsistent mit beiden Pfadmengen P x,y1 und P x,y2 v in x=(v in,v mid ) v mid v out1 v out2 P x,y1 P x,y2 p

43 Der Bauplan des Menschen Beispiel mit multiplen Kanten: nach Transformation P ->x v in x=(v in,v mid ) v mid v out1 z v out2 y 2 =(v mid,v out2 ) P x,y = {p| p enthält x und y 1 } P y-> = {p| p startet mit y 1 } Problem: Wie enden die Pfade in P ->x ? Existiert ein p P ->x mit dieser Eigenschaft, so nennt man x nicht-auflösbar. Nicht-auflösbare Kanten x werden zum Schluss behandelt. Sei p P ->x : Fall 3: p ist konsistent mit beiden Pfadmengen P x,y1 und P x,y2 v in x=(v in,v mid ) v mid v out1 v out2 P x,y1 P x,y2 p

44 Der Bauplan des Menschen Sei x eine nicht-auflösbare Kante (siehe Beispiel unten). In diesen Situationen wendet man Cut-Techniken an. v in x=(v in,v mid ) v mid v out1 v out2 P x-> P ->x Man kürze die Pfade um x. v in x=(v in,v mid ) v mid v out1 v out2

45 Der Bauplan des Menschen Resultate von Pevzner&Tang&Waterman für Neisseria Meningitidis: Länge des Genoms: 2,184,406 bp Fragmente mit durchschnittlicher Länge 400 bp. 126 perfekte Repeats bis zu einer Länge von 3832bp Fehler in den Fragmenten (4.8 per Fragment, 1.2 % Fehlerrate) Fehler wurden durch die Waisenprozedur (M=2) eliminiert Fehler wurden durch die Waisenprozedur produziert eliminiert. l = 20 Tuple-Größe wurde verwendet. 4,081,857 = Zahl der Knoten im de Bruijn Graph bevor das Superpfad-Problem gelöst wurde. 999 = Zahl der Knoten im de Bruijn Graph nachdem das Superpfad-Problem gelöst wurde = Zahl der Kanten im de Bruijn Graph nachdem das Superpfad-Problem gelöst wurde. 122 Zusammenhangskomponenten 5 Stunden Laufzeit auf einer Sun Enterprise E4500/5500


Herunterladen ppt "Der Bauplan des Menschen Sequencing by Hybridization SBH Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002."

Ähnliche Präsentationen


Google-Anzeigen