Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

P ROTEOMICS Van Swieten-Kongress 2001 CGACCTTGATACTTGACCCTGATATCTTGACCCTGATACTTG ACCCTCTTGACCCTGATACCCTGATATCTTGACCCTGATACT TGACCCTCTTGACCCTACCCTGATATCTTGACCCTGATACTT.

Ähnliche Präsentationen


Präsentation zum Thema: "P ROTEOMICS Van Swieten-Kongress 2001 CGACCTTGATACTTGACCCTGATATCTTGACCCTGATACTTG ACCCTCTTGACCCTGATACCCTGATATCTTGACCCTGATACT TGACCCTCTTGACCCTACCCTGATATCTTGACCCTGATACTT."—  Präsentation transkript:

1 P ROTEOMICS Van Swieten-Kongress 2001 CGACCTTGATACTTGACCCTGATATCTTGACCCTGATACTTG ACCCTCTTGACCCTGATACCCTGATATCTTGACCCTGATACT TGACCCTCTTGACCCTACCCTGATATCTTGACCCTGATACTT GACCCTCTTGACTGATATCTTGACCCTGATACTTGACCCTCT TGACCCTTCTTCCGCCTTCTTCCGATCGATCGTGATATCTTG ACCCTGATACTTGACCCTCTTGACCCTTCTTCCGTGATATCT TGACCCTGATACTTGACCCTCTTGACCCTTCTTCCGACCCT GATACTTGACCCTCTTGACTGATATCTTGACCCTGATACTTG ACCCTCTACCACCCTGATACTTGACCCTCTTGACTGATATCT TGACCCTGATACTTGACCCTCTTGACCCTTCTTCCGCCTTCT TCCGATCGATCGTGATATCTGATACTTGACCCTCTTGACTGA TATCTTGACCCTGATACTTGACCCTCTTGACCCTTCTTCCGC CTTCTTCCGATCGATCGTGATATTGACCCTTCTTCCGCCTTC TTCCGATCGATCGTGATATACCCTGATACTTGACCCTCTTGA CTGATATCTTGACCCTGATACTTGACCCTCTTGACCCTTCTT CCGCCTTCTTCCGATCGATCGTGATATCCGACCCTGATACTT GACCCTCTTGACTGATATCTTGACCCTGATACTTGACCCTCT ACCACCCTGATACTTGACCCTCTTGACTGATATCTTGACCCT GATACTTGACCCTCTTGACCCTTCTTCCGCCTTCTTCCGATC GATCGTGATATCTGATACTTGACCCTCTTTCCGCCTTTTCCG CCTTCCG Ein Genom Verschiedene Proteome

2 P ROTEOMICS Van Swieten-Kongress 2001 Ein Genom -verschiedene Proteome > kodierende Gene in höheren Organismen Differenziell gespleisst Posttranslational modifiziert Teilweise abgebaut x Protein Spezies / Organsimus Selektive Expression in Geweben und Zellen > Protein Spezies / Zelle

3 P ROTEOMICS Van Swieten-Kongress 2001 Warum Proteinanalyse ? Genomische Information beschreibt nicht biologische Systeme Schlechte Korrelation zwischen RNA und Protein Menge Das Genom gibt keine Information über dynamische Interaktionen in Zellen Proteine sind die prinzipiellen Zielmoleküle für Drugs (Targets)

4 P ROTEOMICS Van Swieten-Kongress 2001 Zell-spezifische Expression Genom Kultur Bedingungen Temperatur Interaktionen Stress Metabolismus Chemikalien Medikamente Viele Parameter beeinflussen das Proteom


Herunterladen ppt "P ROTEOMICS Van Swieten-Kongress 2001 CGACCTTGATACTTGACCCTGATATCTTGACCCTGATACTTG ACCCTCTTGACCCTGATACCCTGATATCTTGACCCTGATACT TGACCCTCTTGACCCTACCCTGATATCTTGACCCTGATACTT."

Ähnliche Präsentationen


Google-Anzeigen