Die Bedeutung der Defensine in der perioperativen Medizin Malte Book, Frank Stüber Klinik und Poliklinik für Anästhesiologie und Schmerztherapie Inselspital, Bern

Eine Sepsis liegt dann vor, wenn sich innerhalb des Körpers ein Herd gebildet hat, von dem kontinuierlich oder periodisch pathogene Bakterien in den Kreislauf gelangen und zwar derart, daß durch diese Invasion subjektive und objektive Krankheitserscheinungen ausgelöst werden Schottmüller H. Verhandl dt Kongress Inn Med 1914; 31:257-80

Sepsis ist die Gesamtheit der lebensbedrohlichen klinischen Krankheitserscheinungen und pathophysiologischen Veränderungen als Reaktion auf die Aktion pathogener Keime und ihrer Produkte, die aus einem Infektionsherd in den Blutstrom eindringen, die großen biologischen Kaskadensysteme und spezielle Zellsysteme aktivieren und die Bildung und Freisetzung humoraler und zellulärer Mediatoren auslösen. Schuster HP und Müller-Werdan U: Definition und Diagnose von Sepsis und Multiorganversagen in Sepsis und MODS, Springer Berlin Heidelberg (2005)

SIRS nach Trauma N: 1277 Trauma Patienten, 91% zeigen systemische Inflammation ISS Mittelwert: 18 Hoover L, Bochicchio GV, Napolitano LM, Joshi M, Bochicchio K, Meyer W, Scalea TM J Trauma. 2006 Aug;61(2):310-6

Infektion nach SIRS 580 (45%) der Patienten hatten mindestens eine nosokomiale Infektion Hoover L, Bochicchio GV, Napolitano LM, Joshi M, Bochicchio K, Meyer W, Scalea TM J Trauma. 2006 Aug;61(2):310-6

Herausforderung des Gesundheitssystems Inzidenz: 3 von 1.000 Menschen/Jahr 2 von 100 Krankenhauspatienten/Jahr 715.000 Patienten/Jahr Letalität: 29% mehr Tote als durch akuten Myokardinfarkt Kosten: 17.000.000.000 US$/Jahr Angus DC, Crit Care Med 2001; 29:1303-1310

Sepsis + Entzündung SIRS Kriterien Körpertemperatur >38 °C oder <36 °C Tachykardie: Herzfrequenz >90/min Tachypnoe: Atemfrequenz >20 oder Hyperventilation (PaCO2 <4.3 kPa bzw. 33 mmHg) Leukozytose (>12.000 weiße Blutkörperchen/mm3) oder Leukopenie (<4000/mm3) oder >10 % unreife neutrophile Granulozyten im Differentialblutbild American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference: definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis (1992) Crit Care Med

Zeichen der systemischen Inflammation als Antwort auf eine Infektion 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference Crit Care Med (2003) Vol. 31, No. 4

Limitationen [….] these terms do not allow precise characterization and staging of patients with this condition. 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference Crit Care Med (2003) Vol. 31, No. 4

PIRO P redisposition I nfection R esponse O rgan dysfunction

Zwillingsuntersuchungen bei Volkskrankheiten Konkordanzraten MZ DZ Diabetes mellitus Typ 2 0,80 0,35 Herzinfarkt (Frauen) 0,44 0,14 Herzinfarkt (Männer) 0,39 0,26 Prostata-Karzinom 0,27 0,07 Epilepsie (idiopathische) 0,69 0,14 Multiple Sklerose 0,28 0,03 Lippen-Kiefer-Gaumen-Spalte 0,38 0,08 Schizophrenie 0,50 0,12 Manische Depression 0,60 0,10 Tuberkulose 0,37 0,15

Andere infektiologische Komplikationen entwickeln? Warum können einige kritisch kranke Patienten der Keim beladenen Umwelt widerstehen während Andere infektiologische Komplikationen entwickeln?

Hypothese Die Funktion des Innaten Immunsystems wir durch genetische Varianten moduliert

Genom Mutationen

Chromosomen Mutation Deletion Insertion Inversion

Tandem Repeats Mikrosatelliten Minisatelliten ATGGCAGG AAACGGCT 1 – 6 bp, 10 – 100 x wiederholt TTAC TTAC...n=10-100...TTAC TTAC ATGGCAGG AAACGGCT 6 – 100 bp, bis 20 kb Länge CGGATCGGTACAACTAGCGGTAAGCGTGCATCCATC ATGGCAGG AAACGGCT Mindestens 100 bp, mehrere Megabasen Länge CTAGTACCG .. min. 100bp .. TTAACGAGCAG

Single Nucleotide Polymorphisms Frequenz ca. 1/1000 Bp ca. 10.000.000 SNPs/Individuum

Kandidatengene (SNPs) Polymorphism (rs number) Location (functional Relevance) Allele Frequency % Disease association TLR1 A→G rs5743551 -7202 Essential splice site 7.5 Allele G caused higher NF-kB activation and higher cell surface TLR1 expression. In sepsis patients predicted organ dysfunction and death [Wurfel et al. (2008) Am J Respir Crit Care Med 178(7):710-720] TLR2 G→A rs5743708 Exon (753 Arg→Gln) 1.5 Heterozygous patients showed elevated TNF and decreased IFN-g and IL-8 blood concentrations in response to candida sepsis [Woehrle et al. (2008) Cytokine 41(3):322-329] Heterozygous patients with inflammatory bowel diseases showed increased risk for pancolitis [Pierik et al. (2006) Inflamm Bowel Dis 12(1):1-8] rs1898830 Intron 35 Allele is associated with increased shedding and lesional rates in patients with genital Herpes Simplex virus typ 2 infections TLR4 rs4986790 (299 Asp→Gly) 3 Interruption of TLR4 mediated LPS signalling [Arbour et al (2000) Nat Genet 25(2):187-191] LBP T→C rs2232571 CAAT box 11 Association with gram negative bacteremia related mortality after hematopoietic cell transplantation [Chien et al (2008) Blood 111(4):2462-2469] IL-6 G→C rs1800795 Promoter -174 40 Decreased gene transcription after LPS stimulation [Fishman et al (1998) J Clin Invest 102(7):1369-1376] TNF rs 1800629 -308 21 Increase in transcriptional activity following LPS stimulation [Wilson et al (1997) Proc Natl Acad Sci U S A 94(7):3195-3199]. Association with death from meningococcal disease [Nadel et al (1996) J Infect Dis 174(4):878-880]. Increased susceptibility to septic shock and associated with death due to septic shock [Mira et al (1999). JAMA 282(6):561-568] rs361525 -238 7.4 Development of pneumonia in systemic lupus erythematosus is associated with allele A [Kinder et al (2007). Arthritis Rheum 56(8):2679-2686] IRAK 1 C→T rs1059703 Exon 12 (532 Ser→Leu) 18 Increased incidence of shock in septic patients [Arcaroli et al (2006) Am J Respir Crit Care Med 173(12):1335-1341] MIF C→G rs755622 -173 16 Increased MIF plasma levels in patients post CABG surgery [Lehmann et al (2006) Eur J Cardiothorac Surg 30(1):59-63] eNOS G→T rs1799983 Exon 8 (Glu→Asp) 34.2 Risk factor for hypotension in patients with E. coli bacteremia [Huttunen et al (2008) Shock] Kandidatengene (SNPs) TLR1 A→G rs5743551 Allele G caused higher NF-kB activation and higher cell surface TLR1 expression. In sepsis patients predicted organ dysfunction and death [Wurfel et al. (2008) Am J Respir Crit Care Med 178(7):710-720] TNF G→A rs 1800629 Promoter -308 Allele TNF2 showed increased susceptibility to septic shock and associated with death due to septic shock [Mira et al (1999). JAMA 282(6):561-568]

Copy Number Variation (CNV) Gen ROT homologe Chromosomen (2 Gen Kopien pro diploidem Chromosomensatz) Gen GRÜN Gen BLAU

A total of 1,447 copy number variable regions (CNVRs), which can encompass overlapping or adjacent gains or losses, covering 360 megabases (12% of the genome) were identified in these populations. Redon et al. Nature. 2006 Nov 23;444(7118):444-54

Copy number variations Richard Redon et al. Nature 444, 444-454 (23 November 2006)

Innate Immunität Angeboren Unterscheidung selbst/fremd durch molekulare Muster Sehr schnell, bzw. sofort einsatzbereit In der Evolution konserviert

Rezeptoren/Mediatoren Innate Immunität Physikalische Barrieren - Epidermis - Mucosa Rezeptoren/Mediatoren -TLRs -TNF -Interleukine Zelluläre Barrieren - Neutrophile - Makrophagen - NK-Zellen Protein Barrieren - Komplement - Lysozym - Defensine

Over the past several years my laboratory has utilized the Xenopus laevis oocyte system to study RNA expression in eukaryotes (1-5). Ovaries used in these studies were removed surgically from anesthetized adult females. Incisions were made through both the skin and the nonadherent muscular layer of the abdomen into the peritoneum. After removal of the ovaries, the muscular wall and the skin were separately repaired with sutures. Despite the nonsterile surgical procedure and the microbially contaminated water-filled tanks to which the animals were returned immediately after surgery, it was extremely rare for these surgical wounds to develop infection. Indeed, sutures dissolved after several weeks, and normal healing of the scar almost always occurred. Infections were not seen on the cut margins of the wound, at the sites of suture placement, or within the communicating subdermal space or peritoneum. Healing occurred with little gross evidence of inflammation or cellular reaction at the wound sites. The absence of infection under these conditions was medically remarkable. Zasloff M. Proc Natl Acad Sci U S A. 1987 Aug;84(15):5449-53

Antimicrobial Peptides Defensin, Cathelicidin, Hepcidin 15-45 Aminosäuren lang Positiv geladen In der Evolution hoch-konservierte Gene Vorkommen in vielen Geweben Antimikrobielle Wirkung gegen Bakterien, Pilze und Viren Beta–Defensine 2, 3 und 4 mit sehr hoher antimikrobieller Aktivität Immunmodulatorische Wirkung

Defensine Alpha (Helix) Beta (Faltblatt) Gene 11 (Pseudogene) Expression meist konstitutiv meist induzierbar Vorkommen Neutrophile, T-Zellen, NK-Zellen, GIT, Knochenmark epitheliale Organe, monozytäre Zellen, Testis

b-Defensine: Effektormoleküle der Innaten Immunität Milner SM et al Reduced antimicrobial peptide expression in human burn wounds Burns. 1999 Aug;25(5):411-3 Book M, Stuber F et al. Inducibility of the endogenous antibiotic peptide beta-defensin 2 is impaired in patients with severe sepsis. Crit Care. 2007;11(1):R19 Chen QX et al Genomic variations within DEFB1 are associated with the susceptibility to and the fatal outcome of severe sepsis in Chinese Han population. Genes Immun 2007 Jul;8(5):439-43 Kota S et al. Role of human beta-defensin-2 during tumor necrosis factor-alpha/NF-kappaB-mediated innate antiviral response against human respiratory syncytial virus. J Biol Chem. 2008 Aug 15;283(33):22417-29 Soto E et al. Human beta-defensin-2: a natural antimicrobial peptide present in amniotic fluid participates in the host response to microbial invasion of the amniotic cavity. J Matern Fetal Neonatal Med. 2007 Jan;20(1):15-22

Leukozytäre b Defensin-2 Induzierbarkeit in Patienten mit schwerer Sepsis verringert * * p<0.05, Kruskal-Wallis test with Dunn’s multiple comparison test Book M, Chen Q, Stuber F Crit Care. 2007 Feb 15;11(1)

Defensin-2 Plasmaspiegel in Patienten mit schwerer Sepsis erhöht * * * p<0.05, Kruskal-Wallis test with Dunn’s multiple comparison test Book M, Chen Q, Stuber F Crit Care. 2007 Feb 15;11(1)

4 Varianten (SNPs) im hBD2 Gene Promotor NF-kB NF-IL-6 AP-1 Exon 1 CAAT TATA NF-kB NF-IL-6 AP-1 Exon 1 -992G/A -876C/T -233G/C -72T/C

hBD2 Promotor Aktivität: Effekt der SNPs Endotoxin response Wildtype and variant indicate no significant differences in inducible promoter activity

Chromosomale Duplikation auf Chromosom 8 Hollox et al. Am J Hum Genet. 2003 Sep;73(3):591-600

Beta Defensin Copy Number Variation 7250k 7350k 7700k 7800k DEFB4 DEFB4 DEFB103 DEFB103 SPAG11 SPAG11 DEFB104 DEFB104 DEFB106 DEFB106 DEFB105 DEFB105 DEFB107 DEFB107

CYP2D6 Gen Kopie Anzahl Variation CYP2D6 Gen Kopie Anzahl Variation beeinflusst den antiemetischen Effekt und die Plasma Spiegel von Topisetron Episoden des Erbrechens (Mean) Topisetron Serum Konzentration, µg/l Anzahl der CYP2D6 Gene Kaiser et al. J Clin Oncol. 2002 Jun 15;20(12):2805-11

Relative DNA Gen Kopie Anzahl Quantifizierung mit PCR Referenz Gen Ziel Gen Prinzip Ein Kalibrator mit je 2 Kopien Referenz- und Ziel-Gen läuft in jedem Lauf Relative Ratio von Ziel- zu Referenz-Gen wird durch den „crossing point“ berechnet PCR Effizienz korrigierte Quantifizierung Ziel-/Referenz-Gen Ratio von jeder Probe wird geteilt durch Ziel-/Referenz-Gen Ratio des Kalibrators

Quantifizierung der Defensin CNPs Effizienz Berechnung Slope: -3,609 E=10(-1/slope)=1.8927 Slope: -3,575 E=10(-1/slope)=1.9042 Chen Q, Book M, Stuber F J Immunol Methods. 2006 Jan 20;308(1-2):231-40

Proben Quantifizierung Quantifizierung der Defensin CNPs Proben Quantifizierung Chen Q, Book M, Stuber F J Immunol Methods. 2006 Jan 20;308(1-2):231-40

Funktionelle Bedeutung der hBD2 CNVs R2 0,8149, p < 0,05 R2=0,9643, p < 0,05

Ausblick Defensin CNVs Assoziation mit Inflammation, Infektion, Sepsis bei kritisch kranken perioperativen Patienten? Quantitative Modulation der Genexpression bei unterschiedlichen Patienten (z.B. HLM OP, Blood Stream Infection, Peritonitis, Pneumonie)? Quantitative Modulation der Proteinspiegel? Zuordnung zu SNP und CNV Haplotypen?

Hiratsuka et al.Thorax. 2003 May;58(5):425-30

Gen Kopie Anzahl Polymorphismus Wildtyp Homozygoter Wildtyp mit 2 Gen Kopien Homozygote Variante Mutation Heterozygote Variante

TLR1 A→G rs5743551 TNF G→A rs 1800629 Promoter -308 Allele G caused higher NF-kB activation and higher cell surface TLR1 expression. In sepsis patients predicted organ dysfunction and death [Wurfel et al. (2008) Am J Respir Crit Care Med 178(7):710-720] TNF G→A rs 1800629 Promoter -308 Allele TNF2 showed increased susceptibility to septic shock and associated with death due to septic shock [Mira et al (1999). JAMA 282(6):561-568]