Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Genomische Selektion in der Schweizer Schweinezucht Dr. Henning Luther, SUISAG Strickhof Schweinetag 2013.

Ähnliche Präsentationen


Präsentation zum Thema: "Genomische Selektion in der Schweizer Schweinezucht Dr. Henning Luther, SUISAG Strickhof Schweinetag 2013."—  Präsentation transkript:

1 Genomische Selektion in der Schweizer Schweinezucht Dr. Henning Luther, SUISAG Strickhof Schweinetag 2013

2 Strickhof Schweinetag nur das Erbgut können wir als Tierzüchter durch Selektion verändern Die besseren Leistungen sind dann eine Folge der Selektion Quelle: Urs Schuler QUALITAS Zuchtwert = Einschätzung des Genotyp

3 Verbliebene Nachteile BLUP ZWS Die heute verwendete BLUP Zuchtwertschätzung hat gegenüber den früheren ZWS-Verfahren gewaltige Vorteile gebracht Deshalb hat man sie in allen Tierarten in den Neunzigern eingeführt als die Rechenleistung der Computer dies zuliess mehr Zuchtfortschritt Bestimmte grundlegende Probleme verblieben: Bei jungen Tieren (keine / wenig Information vorhanden) können die Zuchtwerte nur unsicher geschätzt werden Strickhof Schweinetag 20133

4 Verlauf der RZW Zuchtwerte Die 33 ES KB-Eber des Geburtsjahr Strickhof Schweinetag 20134

5 Was bedeutet das Bestimmheitsmass? Strickhof Schweinetag 20135

6 Was bedeutet das Bestimmheitsmass? Strickhof Schweinetag Zuchtwerte schätzen ist ganz klar besser als Roulette zu spielen! Sonst hätten wir ja keinen Zuchtfortschritt ABER: Zuchtwerte sind und bleiben Schätzwerte!

7 Verbliebene Nachteile BLUP ZWS Die BLUP-ZWS hat gegenüber den früheren ZWS-Verfahren gewaltige Vorteile gebracht Deshalb hat man sie in allen Tierarten in den Neunzigern eingeführt als die Rechenleistung der Computer dies zuliess Bestimmte grundlegende Probleme verblieben: Bei jungen Tieren (keine / wenig Information vorhanden) können die Zuchtwerte nur unsicher geschätzt werden Vollgeschwister haben bis zur Eigenleistungsprüfung bzw. Nachkommenprüfung identische Zuchtwerte (innerhalb Vollgeschwister ist aber die Hälfte der gesamten genetischen Variation vorhanden!) Strickhof Schweinetag 20137

8 Zwei ES Vollbrüder in der KB Strickhof Schweinetag BOBI BKE BOND BKE Geburt Eintritt in KB LTZ( )656 g/Tag624 g/Tag RSD( ) 9.2 mm 8.8 mm RZW( )128 (29%) 128 (29%) PZW( )121 (40%)116 (40%) RZW identisch!

9 Zwei ES Vollbrüder in der KB Strickhof Schweinetag BOBI BKE BOND BKE Geburt Eintritt in KB LTZ( )656 g/Tag624 g/Tag RSD( ) 9.2 mm 8.8 mm RZW( )128 (29%) 128 (29%) PZW( )121 (40%)116 (40%) Geburt Eintritt in KB LTZ( )656 g/Tag624 g/Tag RSD( ) 9.2 mm 8.8 mm RZW( )128 (29%) 128 (29%) PZW( )121 (40%)116 (40%) RZW( ) 62 (92%)26 Punkte 88 (94%) PZW( ) 53 (82%)21 Punkte 74 (88%)

10 Zwei ES Vollbrüder in der KB Strickhof Schweinetag BOBI BKE BOND BKE Geburt Eintritt in KB LTZ( )656 g/Tag624 g/Tag RSD( ) 9.2 mm 8.8 mm RZW( )128 (29%) 128 (29%) PZW( )121 (40%)116 (40%) Geburt Eintritt in KB LTZ( )656 g/Tag624 g/Tag RSD( ) 9.2 mm 8.8 mm RZW( )128 (29%) 128 (29%) PZW( )121 (40%)116 (40%) RZW( ) 62 (92%)26 Punkte 88 (94%) PZW( ) 53 (82%)21 Punkte 74 (88%) Hätte man das schon 2001 gewusst, so wäre nur BOBI zur KB gekommen, weil er die besseren Erbanlagen von seinen Eltern gererbt hat Das stand auch 2001 schon in BOBIs DNA drin ! Wir hatten nur keine Technik das abzulesen

11 Prinzip Genomische Selektion Am Beispiel CF Strickhof Schweinetag Vater A/G Mutter A/G Wer bekommt zufällig das gute A-Allel vom Vater bzw. Mutter vererbt? Mendelsche Regel: 25% A/A, 50% A/G, 25% G/G Aber wer ist was von den Vieren???? Sohn 1 CF18 ? Sohn 2 CF18 ? Sohn 3 CF18 ? Sohn 4 CF18 ?

12 Prinzip Genomische Selektion Am Beispiel CF Strickhof Schweinetag Vater A/G Mutter A/G Durch Typisieren der DNA jedes Eberferkels finden wir es ganz früh heraus !!! den zur KBden schlachten Sohn 1 A/G Sohn 2 A/A Sohn 3 A/G Sohn 4 G/G

13 Genomische Selektion Die modernstes Zuchtwertschätzung Strickhof Schweinetag 2013 Theo MeuwissenBen HayesMike Goddard Heute das ZWS Standardverfahren - Praktische Anwendung in Zuchtprogrammen ist unterschiedlich Erste Unternehmen haben begonnen - erhöht Züchtungskosten (Kosten bei Zuchtunternehmen) - wohl mehr Zuchtfortschritt (Nutzen bei Kunde) Wer hats erfunden??? Typisierungschip für 12 Tiere 13

14 Strickhof Schweinetag Mit diesem Chip kann man die DNA von 12 Tieren an jeweils Stellen gleichzeitig ablesen Kosten 100 CHF / Tier

15 Strickhof Schweinetag Das kommt im Prinzip aus dem Labor zurück einzelne Genotypen Ist dieses Tier nun züchterisch gut oder schwach ???

16 Strickhof Schweinetag Man typisiert zu Beginn viele Tiere, die schon möglichst genaue konventionelle Zuchtwerte haben Lernstichprobe (KB-Eber, Sauen, etc.) Masttagszunahmen Der Effekt von einem zusätzlichen B an diesem Marker ist: + 10g/Tag MTZ

17 Strickhof Schweinetag

18 Strickhof Schweinetag

19 Genomische Selektion Erwartete Vor- und Nachteile Typisierte Vollgeschwister verschiedene Zuchtwerte effizientere Selektion innerhalb Vollgeschwister Typisierte Jungtiere haben etwas genauer geschätzte Zuchtwerte effizientere Selektion (mehr ZF, weniger Nieten in KB) wie viel genauer werden die Zuchtwerte sein ????? Eventuell Einsparung zusätzlicher Gentests möglich (CF18, MHS, Coli_CH, Abstammungskontrolle etc.) Die Züchtungskosten steigen (Labor & ZWS) Es bleibt aber eine Zuchtwertschätzung ! Strickhof Schweinetag

20 Genomische Selektion genauere Zuchtwerte für junge Tiere Strickhof Schweinetag Bei EASTON & MABEL stand bei ihrer Geburt schon in ihrer DNA drin, dass ihre Töchter später schwache Leistungen bringen werden (bei LABAN umgekehrt) Mit Genomischen Zuchtwerten hätte man EASTON & MABEL wahrscheinlich gar nie für KB selektierte und somit gar nicht erst schwache Töchter erzeugt

21 Genomische Selektion Was macht die SUISAG? Dr. Henning Luther, SUISAG Strickhof Schweinetag 2013

22 Genomische Selektion beim Schwein International Bei grossen Zuchtunternehmen etabliert (DK) Bei kleinen in der Aufbauphase German Piétrain, Bayerische Landrasse FBF-Projekt bei Mutterlinien (BHZP, SUISAG, German Genetic, Bayern, AUT) SUISAG Beteiligung bei FBF-Projekt ( ): Grundlagen, keine Umsetzung Dank verschiedenen Forschungsprojekten sind CH-Tiere bereits typisiert auf Kosten dieser Projekte ­ ES: 400 KB-Eber und 500 Sauen Gute Basis für Aufbau einer GS für ES-Mutterlinie Strickhof Schweinetag

23 Etablierung Genomische Selektion bei SUISAG Projektdauer etwa 2 Jahre Start Probensammlung Herbst/Winter 2012 Projektbeginn Sommer 2013 (nach Rückkehr A. Hofer) Projektziele Typisierung von DNA-Proben ausländische Labor Verwaltung der Typisierungsresultate bei SUISAG Genomische Zuchtwertschätzung für Routinebetrieb bei SUISAG etablieren ­ zunächst: Edelschwein Mutterlinie Strickhof Schweinetag

24 DNA Sammlung für Lernstichprobe SUISAG lagert routinemässige DNA-Material von jedem KB-Eber und jedem MLP-Prüftier 400 Edelschwein KB-Eber bereits typisiert im Rahmen von anderen Forschungsprojekten 500 Edelschwein Sauen Haarproben genommen auf 10 Betrieben Typisierung fast fertig Wir brauchen noch mehr DNA-Proben von Sauen mit Würfen für die Lernstichprobe und die Zukunft Strickhof Schweinetag

25 DNA Sammlung von Kernzuchtsauen Kernzuchtbetriebe schicken Haarprobe von jeder Edelschwein Sau, die das erste Mal bei ihnen abferkelt an SUISAG Als DNA Bank Zusätzlich Haarproben von Sauen die schon mindestens 2 Würfe haben Für baldige Erweiterung Lernstichprobe Rücksendung z.B. mit Sauenblatt nach Absetzen Strickhof Schweinetag

26 Geplante erste Anwendung Edelschwein Kandidaten für KB Strickhof Schweinetag Beprobung Eberferkel nach Ankunft in zentraler Eberaufzucht Sempach Typisierung Genomisch optimierter Zuchtwert nach Eigenleistungsprüfung Gutes Kosten / Nutzenverhältnis, weil zukünftige KB-Eber Väter vieler Jungsauen Selektion auf Basis GOZW Für Ausbau Lernstichprobe Natursprung ?

27 Durch Imputing Typisierungskosten senken Bei einem Tier die DNA an SNP ablesen lassen kostet derzeit 100 CHF Strickhof Schweinetag GTCATAGCATTATTATTATTATTCAGGACCCGGATTTGGACGTTCCAAAGCTATAACCGGG CAGTATCGTAATAATAATAATAAGTCCTGGGCCTAAACCTGCAAGGTTTCGATATTGGCCC GTCATAGCATTATTATTATTATTCAGGACCCGGATTTGGACGTTCCAAAGCTATAACCGGG CAGTATCGTAATAATAATAATAAGTCCTGGGCCTAAACCTGCAAGGTTTCGATATTGGCCC Originale DNA-Sequenz des Tiers: Typisierungsergebnis des Illumina Chips: Was um Himmels willen ist nun auch noch Imputing ???

28 Durch Imputing Typisierungskosten senken Strickhof Schweinetag GTCATAGCATTATTATTATTATTCAGGACCCGGATTTGGACGTTCCAAAGCTATAACCGGG CAGTATCGTAATAATAATAATAAGTCCTGGGCCTAAACCTGCAAGGTTTCGATATTGGCCC GTCATAGCATTATTATTATTATTCAGGACCCGGATTTGGACGTTCCAAAGCTATAACCGGG CAGTATCGTAATAATAATAATAAGTCCTGGGCCTAAACCTGCAAGGTTTCGATATTGGCCC Originale DNA-Sequenz des Vaters: Typisierungsergebnis des Illumina Chips vom Vater (KB-Eber): GTCATAGCATTATTATTATTATTCAGGACCCGGATTTGGACGTTCCAAAGCTATAACCGGG CAGTATCGTAATAATAATAATAAGTCCTGGGCCTAAACCTGCAAGGTTTCGATATTGGCCC Typisierungsergebnis eines Nachkommen mit 6000 Chip (Kosten evtl. 50CHF): GTCATAGCATTATTATTATTATTCAGGACCCGGATTTGGACGTTCCAAAGCTATAACCGGG CAGTATCGTAATAATAATAATAAGTCCTGGGCCTAAACCTGCAAGGTTTCGATATTGGCCC Weil man alle SNP vom Vater kennt, weiss man über den Nachkommen: Imputing

29 Vor- und Nachteile Imputing Die Selektionskandiaten (viele Tiere!) und ggf. später auch Sauen werden mit einem günstigeren Low-Density Chip typisiert Senkt die Typisierungskosten derzeit noch deutlich Die Väter dieser Tiere müssen mit dem Chip typisert sein (KB-Eber Chip typisieren!) Dann kein/kaum Genauigkeitsverlust durch Imputing 6000 Chip (noch) nicht verfügbar Kosten des Chips nicht bekannt aber 50CHF/Tier realistisch Rechenaufwand Imputing ist relativ hoch Strickhof Schweinetag

30 Natursprung bei Genomischer Selektion Die Zuchtwerte der Edelschwein KB-Eber werden mit Genomischer ZWS genauer geschätzt sein, weil die Zuchtwerte auch auf DNA Information des typisierten Ebers beruhen! KB-Eber verwenden, weil noch besser selektiert ! Man könnte daneben auch Natursprungeber im Kernzuchtbetrieb einsetzen. Die müssten dann aber auch mit Chip typisiert sein Dann gleiche Genauigkeit wie bei KB-Ebern Nur dann Imputing der Nachkommen auch gut machbar Strickhof Schweinetag

31 Fazit Genomische Selektion wird zum Standard in erfolgreichen Zuchtprogrammen werden Rind, Schwein, Geflügel, Pflanzen! Genomische Selektion wird die Schweinezucht nicht so revolutionieren wie die Rinderzucht Grund: Wir arbeiten schon mit jungen Zuchttieren = kurzes Generationenintervall haben wir schon! Die zusätzlichen laufenden Kosten der GS sind jetzt überschaubar aber Schweinezucht wird etwas teurer durch Genomische Selektion Strickhof Schweinetag

32 Fazit Das Thema Genomische Selektion ist komplex Das war/ist klassische BLUP-Zuchtwertschätzung aber auch Als Praktiker sollte man wissen, welche Vorteile durch GS in der Schweinezucht zu erwarten sind Etwas genauer geschätzte Zuchtwerte bei jungen Tieren Unterschiedliche Zuchtwerte für typisierte Vollgeschwister Durch beides etwas effizientere Selektion und etwas höherer Zuchtfortschritt Vermutlich weniger Zuchtwert-Abstürze bei KB-Ebern Strickhof Schweinetag

33 Fazit Die SUISAG arbeite sich Schritt für Schritt in die Genomische Selektion (Zuchtwertschätzung) ein Es ist eine grosse Herausforderung für und ! Wir wissen schon wo und wie wir es zu Beginn anwenden möchten (zentrale ML-Eberaufzucht) Keine Schnellschüsse! Strickhof Schweinetag

34 Vielen Dank für Ihr Interesse! Strickhof Schweinetag Das war ein Riesen Schritt für die Menschheit Genomische Selektion: Ein grosser Schritt in der Tierzucht…


Herunterladen ppt "Genomische Selektion in der Schweizer Schweinezucht Dr. Henning Luther, SUISAG Strickhof Schweinetag 2013."

Ähnliche Präsentationen


Google-Anzeigen