Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

DNA - Computing Seminar 2001 Institut Wissenschaftliches Rechnen TU Braunschweig.

Ähnliche Präsentationen


Präsentation zum Thema: "DNA - Computing Seminar 2001 Institut Wissenschaftliches Rechnen TU Braunschweig."—  Präsentation transkript:

1 DNA - Computing Seminar 2001 Institut Wissenschaftliches Rechnen TU Braunschweig

2 Überblick Historische Entwicklung Biologische Grundlagen Hamilton Path Problem (HPP) Kombinatorische DNA – Lösung des HPP Modelle von DNA-Computing Nanostrukturen der DNA Ausblick

3 Einführung 1993Adleman lernt die Grundlagen der Molekularbiologie 1994Adleman löst das HPP mit Hilfe von DNA 1994Publizierung seiner Ergebnisse 1995Formalisierung des ersten Modells durch Lipton HeuteBreite Forschung mit weltweiten Konferenzen

4 Biologische Grundlagen DNA als Informationsspeicher des DNA-Computers Operationen eines DNA-Computer Informationen kodieren schreiben lesen manipulieren

5 D N A 1944 von Avery entdeckt Gundbaustein der Natur besteht aus einzelnen Nukleotiden (Oligonukleotide) Zucker (desoxyribose) Phosphatgruppe Base

6 Detaillierter Aufbau eines Nukleotids

7 D N A Modell der DNA -Doppelhelix strickleiterartiger Doppelstrang aus gleichlangen Polynukliotidketten 53 53

8 DNA als Informationsträger herkömmliche Computer haben Alphabet X = {0, 1} DNA besitzt Alphabet X = {A, T, G, C} Die DNA eines Menschen umfasst 6 Milliarden Basenpaare was einer Information von ca. 500 Büchern mit 1500 Seiten entspricht.

9 Amplifying (Replikation)

10 Annealing / Melting Melting (erhitzen) Annealing (abkühlen)

11 Synthesizing

12 Cutting

13 Separating

14 Extracting

15 Substituting

16 Detecting / Reading Verwendung von PCR / Gelelektophorese Einsatz von Blockmitteln bei der PCR daraus resultieren kleinere Einzelstränge, die mit dem Hauptstrang zusammenhängen durch veränderte Gelelektrophorese werden Positionen bestimmt Neuere Methoden verwenden Leuchtstofffärbungen statt der PCR, die bei der Gelelektrophorese erkannt werden.

17 ...weitere Operationen Mixing (Crossover) Ligating (Konkatenation) Marking / Unmarking Destroying (Exonuclease Enzyme)

18 Ein DNA-Programm Gefäß mit in DNA kodierter Eingabe...Synthesizing......Marking......Ligating......Reading Ausgabe durch Detection als true / false oder wieder durch DNA kodiert

19 Hamilton Path Problem Gegeben: Ein gerichteter Graph, ein Start- und ein Endknoten Gesucht:Ein Pfad vom Start- bis zum Endknoten, wobei jeder Knoten genau einmal besucht werden muß Richtiger Weg:

20 Lösen des HPP 1. Erzeuge eine Menge von zufällig bestimmten Pfaden durch den Graphen 2.Für alle Pfade in dieser Menge: a.Beginnt der Pfad mit dem Startknoten und endet mit dem Endknoten ? b.Enthält der Pfad genau |V| Knoten ? c.Sind alle Knoten im Pfad vorhanden? 3. Alle Pfade in der verbleibenden Menge sind Lösungswege, ist die Menge leer gibt es keine Lösung.

21 Umsetzung des Algorithmus mit DNA - Sequenzen Kodierung der Knoten und Kanten als DNA-Sequenzen durch Synthetisierung Länge der Sequenzen jeweils 20 Basen Jeder Knoten und jede Kante eindeutig

22 Knoten und Kanten TCAGGTCGAG GCCTACGTAG Knoten A Knoten B AGTCCAGCTCCGGATGCATC Kante A B Komplement

23 Erzeugung aller Pfade TGAATCGACTTCCGATAGCT TGAACTGGGATCTAGCTAGC Moleküle 0,9 % NaCL 100 Mikroliter Kochsalzlösung = TT-100

24 Erzeugung aller Pfade II Hybridisierung von Knoten und Kanten Ligation, zur Verstärkung des Rückrats der DNA

25 Ausfilterung der Pfade ohne richtigen Start- und Endknoten Melting Trennung der Doppelhelix Hinzugabe von Sequenzen der Start- und Endknoten als Primer DNA-Polymerase vermehrt die DNA-Sequenzen unterschiedlich: Mit Start- und Endknoten exponentiell Mit Start- oder Endknoten verdoppelt Mit keiner Entsprechung gar nicht Nach mehren Zyklen des Erwärmens, Abkühlens und Vermehrens wird eine Probe entnommen, die jetzt fast nur noch Pfade einen richtigen Start- und Zielknoten enthält.

26 Kontrolle der Länge Ein richtiger Pfad muß genau 140 bp (=Basenpaare) lang sein 7 Knoten a 20 Basenpaaren DNA-Sequenzen laufen elektrophoretisch über ein Agarose-Gel

27 Überprüfung der Existenz jeden Knotens Wiederholung für alle Knoten mit entsprechenden Sonden Melting, damit DNA-Einzelstränge vorliegen Einbringung von Eisensonden mit Komplementstrang eines Knoten Durch Anbringung eines Magneten bleiben alle Moleküle haften, die diesen Knoten enthalten Abgießen der Lösung und neue Lösung ansetzen Melting trennt Stränge von Sonden Abgießen der Lösung in ein neues Reagenzglas Falls noch DNA vorhanden ist, muß das die Lösung des Problems sein.

28 Eisensonden mit DNA- Sequenzen Sonden-DNA Eisenkugel Enthaltener Knoten Nicht passende DNA

29 Rückblick Alle Pfade Alle Pfade mit v S und v E Alle Pfade mit der Länge |V| Knoten 1 enthalten Knoten 2 enthalten Knoten n enthalten = Lösungsmenge

30 Fehler beim DNA-Computing Pfad wird nicht erzeugt Operationen arbeiten nicht fehlerfrei Falsche Lösungen bleiben erhalten Fehlerursache Größe, Menge und Masse der DNA Nur statistisch wahrscheinliche Lösung !

31 Beschränktes Modell DNA-Menge nimmt in der Berechnungsphase nicht mehr zu DNA-Menge ist in der Initialisierungsphase beschränkt Anwendung von PCR wird ausgeschlossen

32 Beschränktes Modell Bitvektoren kodierende Sequenzen werden erzeugt..... A0A0 A1A1 A2A2 A n-1 AnAn X 0 =1 X 0 =0 X 1 =1 X 1 =0 X n-1 =1 X n-1 =0 Vorteil: Wiederverwendung der Bitstrings für andere Probleme

33 Beschränktes Modell Operationen Extraction Sequenzen werden getrennt, abhängig ob Subsequenz vorhanden Merge Vereinigung zweier Mengen von DNA Detection Test, ob DNA überhaupt noch vorhanden

34 Unbeschränktes Modell Erweiterung des beschränkten Modelles durch Adleman Menge der DNA darf zunehmen Erweiterte Operation: Amplify (PCR)

35 Generator-Modell Initialisierungsmenge effizienter nutzen Suchraum einschränken

36 Generator-Modell Operationen Split Zufällige Aufteilung der DNA-Menge in zwei Mengen Append Verlängerung der Sequenzen um Sequenzteile Merge Vereinigung von zwei DNA-Mengen Iteratives Anwenden von Split - Append - Merge erzeugt zufällige Bitvektoren. Wenn Split - Merge an bestimmten Positionen wegge- lassen wird, haben alle Sequenzen an der Stelle die gleiche Bitbelegung. Der Suchraum hat eine Dimension weniger.

37 Surface-Modell DNA-Sequenzen fixiert auf einer Oberfläche Bessere Kontrolle Einengung des Suchraums Modell wird verwendet, um Erkenntnisse über Operationen und deren Fehler zu gewinnen

38 Nanostrukturen von DNA DNA-Cube

39 Nanostrukturen von DNA Watson-Crick komplementär bildet Doppelhelix eine Zelle bildet verschiedene geometrische Gebilde Verhalten der Kreuzung ist vorhersagbar Oligonukleotide bis hin zu Superstrukturen können zur Realisierung verschiedener Rechenmodelle benutzt werden

40 Nanostrukturen von DNA self-assembly DNA kleine Anzahl von Oligonukleotiden bildet self-assembled DNA-Stränge self-assembly entspricht gewissen Regeln

41 self-assembly - Einsatz Durch die Definition verschiedene Operationen auf den verschiedenen Strukturen kann folgender Einsatz erreicht werden linear doppelte DNA-Sequenz entspricht regulärer Sprache self-assembled verzweigte DNA kann kontextfreie Sprachen erzeugen doppelte Crossover-Moleküle sind geeignet für universelle Berechnungen

42 small Bricks

43 T A E Triple Doppelhelix mit anti-parallelen Überkreuzungen und einer geraden Anzahl von Halbdrehungen

44 T A O Geeignet für Xor - Funktion / Integer - Addition

45 D A E Geeignet für Integer - Addition / Lösen des HPP X Y Z W Im folgenden Gebrauch schematisch dargestellt als:

46 Ein-/Ausgabe mit Nanostrukturen

47 Adleman Graph

48 Ablauf des Algorithmus Erzeugen aller Pfade von Knotenpunkt 1 zu Knotenpunkt N. Sortieren der Knoten in jedem Pfad in ansteigender Ordnung. Kontrolle für jeden Pfad, dass das Resultat genau 1,2, 3,...N ist. Ausgabe jedes Weges, der den Test erfüllt, wenn es einen gibt.

49 Erzeugen aller Pfade

50 Sortieren Sortieren der einzelnen Reihen durch Odd-Even-Transposition Sort

51 Komplettieren der Struktur Einfügen spezieller End - Einheiten DONE kann die Struktur in den Finalzustand überführen

52 Beispielergebnisse Gültiger Hamilton-Pfad (1,4,5,2,3,6,7)

53 Beispielergebnisse Ungültiger Pfad (1,2,3,4,5,2,3,6,7)

54 Vergleich der Algorithmen Adleman: N (Nodes) + E (Edges) Oligonukleotide N Laborschritte (durch Separating) self-assembled: E² / N + N² + N DAE Einheiten konstante Anzahl von Laborschritten (Synthesizing, Annealing, Sequenzing)

55 Ausblick und Bewertung Vorteile Hohe Parallelität der Berechnung – Maximum 2 70 DNA-Stränge in einem Reagenzglas Hohe Energieeffizienz – 1 Joule schafft 2*10 19 Operationen Geringer Platzbedarf – 1 Bit braucht 1nm³

56 Ausblick und Bewertung Nachteile Viele Operationen sind zeitaufwendig – insbesondere Ein- und Ausgabe NP-Probleme bleiben immer noch NP- Probleme Operationen können fehlerhaft sein Statistisches Verfahren Kostenaufwendig

57 Ausblick und Bewertung Interessant für Forschung und Technik (Medizin). Evolutionäre Algorithmen... DNA-Computer werden in den nächsten 40 Jahren von-Neumann-Rechner für den Home-User nicht ablösen.

58 The End Viel Spaß auf dem Sportfest PROST.


Herunterladen ppt "DNA - Computing Seminar 2001 Institut Wissenschaftliches Rechnen TU Braunschweig."

Ähnliche Präsentationen


Google-Anzeigen