Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

V13 Zusammenfassung (V1 – V12)

Ähnliche Präsentationen


Präsentation zum Thema: "V13 Zusammenfassung (V1 – V12)"—  Präsentation transkript:

1 V13 Zusammenfassung (V1 – V12)
Inhalt dieser Veranstaltung: Softwarewerkzeuge für I Sequenzanalyse II Analyse von Proteinstruktur und Ligandenbindung III Zell- bzw. Netzwerksimulationen auf den folgenden Folien ist der klausurrelevante Teil der Vorlesung zusammengefaßt.

2 Organisatorisches: Scheinvergabe
- Bewertung: Vorlesung zählt 2V + 2P = 9 Leistungspunkte Curriculum: Pflichtvorlesung für die Vertiefung „Bioinformatics“ (neue PO) kann für CMB-Bachelor eingebracht werden Wahlfach Pharmazie/Diplom, M.Sc. Biotechnologie - Benotung der Scheine: 50% der Benotung ergibt sich aus der mittleren Benotung von drei praktischen Aufgaben, die während des Semesters von jedem Studenten einzeln zu bearbeiten sind. Die Aufgaben werden etwa alle 4 Wochen ausgegeben und sind innerhalb von 2 Wochen zu bearbeiten und durch ein mindestens 5-seitiges Protokoll zu dokumentieren. Jeder Student muss mindestens zwei der drei praktischen Aufgaben mit einer Note von 4 und besser bestehen. Am Ende des Semesters wird eine 2-stündige Klausur über die Inhalte der Vorlesung und der Übungen geschrieben. Die Klausurnote geht ebenfalls mit 50% in die Scheinnote mit ein. Die Klausur muss mit einer Note von 4 und besser bestanden werden.

3 Sequenzanalyse 1

4 Ziele (0) Identifiziere alle menschlichen Proteine (ORFs) und ihre Funktion Sind dies alle Proteine? Nein: post-translationelle Modifikationen möglich wie Methylierung, Phosphorylierung, Glykosilierung … Identifiziere Gen-Netzwerke. Welche Proteine wechselwirken miteinander? (2) Identifiziere Module: abgeschlossene Einheiten (3) Identifiziere Sequenz-Abschnitte, in denen Mutationen für Krankheiten codieren

5 Proteinstruktur  Sequenz
Was hat nun Sequenz-Konservierung mit Proteinstrukturen zu tun? sehr viel! Die Twilight zone kennzeichnet das Mass an Sequenzidentität, bis zu der zwei Proteinstrukturen mit hoher Wkt. die gleiche Struktur besitzen. Richtlinien von Doolittle: Sequenzen mit > 150 Residuen und  25% Sequenzidentität sind wahrscheinlich verwandt mit 15-20% Sequenzidentität können sie verwandt sein bei <15% Sequenzidentität ist es schwierig zu sagen ob sie verwandt sind oder nicht ohne weitere strukturelle oder funktionelle Hinweise TWILIGHT ZONE 1

6 Proteinstruktur  Sequenz
Konservierung von Residuen sind Indizien für den Verwandtschaftsgrad von Proteinen, für die Evolution und für die Verwandtschaft von Organismen Q: aus welchen Gründen können bestimmte Bereiche der Proteinsequenz konserviert sein? Konservierung von Residuen im aktiven Zentrum Konservierung von Residuen, die die Architektur der Proteinstruktur stabilisieren Konservierung von Residuen, die während Faltung des Proteins wichtig sind Konservierung von Residuen an Bindungsschnittstellen für Liganden und andere Proteine 1

7 Eigenschaften der Aminosäuren
Aminosäuren unterscheiden sich in ihren physikochemischen Eigenschaften. Q: müssen Bioinformatiker die Eigenschaften von Aminosäuren kennen?

8 Transmembrandomänen: Hydrophobizitätsskalen
TM Helices sind  20 Residuen lange Abschnitte aus vorwiegend hydrophoben Resiuden. Stephen White group, UC Irvine

9 V2 Paarweises Sequenzalignment
Methoden des Sequenzalignments Áustauschmatrizen Bedeutsamkeit von Alignments BLAST, Algorithmus – Parameter – Ausgabe Diese Vorlesung lehnt sich eng an das BLAST Tutorial- Buch (links) an, Kapitel 3-9 siehe auch Vorlesung Bioinformatik I von Prof. Lenhof, Wochen 3 und 5 Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches.

10 Sequenz-Alignment Wenn man 2 oder mehr Sequenzen vorliegen hat, möchte man zunächst einmal ihre Ähnlichkeiten quantitativ erfassen Entsprechungen zwischen einzelnen Bausteinen beider Sequenzen erfassen Gesetzmässigkeiten der Konservierung und Variabilität beobachten Rückschlüsse auf entwicklungsgeschichtliche Verwandschaftsverhältnisse ziehen Wichtiges Ziel: Annotation, z.B. Zuordnung von Struktur und Funktion Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches.

11 Why do sequence database searching
Suche in Datenbanken Identifiziere Ähnlichkeiten zwischen einer neuen Testsequenz, deren Struktur und Funktion unbekannt und nicht charakterisiert ist und Sequenzen in (öffentlichen) Datenbanken deren Strukturen und Funktionen bekannt sind. N.B. Die ähnlichen Regionen können die ganze Sequenz, oder Teile von ihr umfassen! Lokales Alignment  globales Alignment Why do sequence database searching •What have I cloned ? •Is this really “my gene” ? •Has someone else already found it ? •Is it interesting anyway? •What is it related to ? •Can I get more sequence easily ?

12 Ähnlichkeit von Aminosäuren
Margaret Dayhoff stellte die Ähnlichkeit (beobachtete Austauschhäufigkeiten zwischen verwandten Sequenzen) zwischen Aminosäuren als log2 odds Verhältnis, oder lod score dar. Lod score einer Aminosäure: nehme den Logarithmus zur Basis 2 (log2) von dem Verhältnis der beobachteten Häufigkeit für ein Paar durch die zufällig für das Paar erwartete Häufigkeit. Lod score = 0 → beobachtete und erwartete Häufigkeiten sind gleich > 0 → ein Austauschpaar tritt häufiger auf als zufällig erwartet < 0 → unwahrscheinlicher Austausch Allgemeine Formel für den Score sij von zwei Aminosäuren i und j. Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches. mit den individuellen Häufigkeiten pi und pj, und der Paarungsfrequenz qjj,

13 Ähnlichkeit der Aminosäuren
Beispiel: die relative Häufigkeiten von Methionin und Leucin seien 0.01 und 0.1. Durch zufällige Paarung erwartet man 1/1000 Austauschpaare Met – Leu. Wenn die beobachtete Paarungshäufigkeit 1/500 ist, ist das Verhältnis der Häufigkeiten 2/1. Im Logarithmus zur Basis 2 ergibt sich ein lod score von +1 or 1 bit. Wenn die Häufigkeit von Arginin 0.1 und die Paarung mit Leu mit Häufigkeit 1/500 ist, dann ergibt sich ein lod score für ein Arg – Leu Paar von bits. Gewöhnlich berechnet man nats, multipliziert die Werte mit einem Skalierungsfaktur und rundet sie dann auf Integer Werte → Austauschmatrizen PAM und BLOSUM. Diese Integer-werte nennt man raw scores. Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches.

14 Bewertungs- oder Austausch-Matrizen
dienen um die Qualität eines Alignments zu bewerten Für Protein/Protein Vergleiche: eine 20 x 20 Matrix für die Wahrscheinlichkeit mit der eine bestimmte Aminosäure gegen eine andere durch zufällige Mutationen ausgetauscht werden kann. Der Austausch von Aminosäuren ähnlichen Charakters (Ile, Leu) ist wahrscheinlicher (hat einen höheren Score) als der von Aminosäuren unterschiedlichen Charkters (e.g. Ile, Asp). Matrizen werden als symmetrisch angenommen, besitzen also Form einer Dreiecksmatrix. Contains scores for matches between residues, according to observed substitution rates across large evolutionary distances Scoring Matrices are designed to detect signal above background, to detect similarities beyond what would be observed by chance alone. All algorithms to compare protein sequences rely on some scheme to score the equivalencing of each of the 210 possible pairs of amino acids. (i.e. 190 pairs of different amino acids + 20 pairs of identical amino acids). 20x20=400-20=380/2=190 The choice of matrix determines both the pattern and the extent of substitution in the sequences the database search is most likely to discover

15 Substitutions-Matrizen
Nicht alle Aminosäuren sind gleich Einige werden leichter ausgetauscht als andere Bestimmte Mutationen geschehen leichter als andere Einige Austausche bleiben länger erhalten als andere Mutationen bevorzugen bestimmte Austausche Einige Aminosäuren besitzen ähnliche Codons Diese werden eher durch Mutation der DNA mutiert Selektion bevorzugt bestimmte Austausche Einige Aminosäuren besitzen ähnliche Eigenschaften und Struktur The two forces together yield substitution matrices (From computational biology) Example of CODONS: TTT & TTC code for Phe TTA & TTG code for Leu

16 PAM250 Matrix 1) Notice 1 lettercode for the amino acids on both axes are the 20 aa note blocks of similar amino acids 2) Symmetric, only one half shown 3) Diagonal: * For example: high score for matching Tryptophans and “low” score for matching Alanines. * Cysteine * Leu abundant 4) Off-diagonal Groups of similar amino acids K -> F -5 A score above zero assigned to two amino acids indicates that these two .. Each other more often than expected by chance alone. Ie they are functionall.. Exchangable A negative score indicates that the two amino acids are rarely .. Interchangeable. Eg. A basic amino acids for an acidic one or one with an … side chain for one with aliphatic side chain.

17 Beispiel für eine Bewertung
log (A B) = log A + log B  Die Bewertung (Score) eines Alignments ist die Summe aller Bewertungen für die Paare an Aminosäuren (Nukleinsäuren) des Alignments: Sequenz 1: TCCPSIVARSN Sequenz 2: SCCPSISARNT => Alignment Score = 46

18 Dayhoff Matrix (1) wurde von M.O. Dayhoff aufgestellt, die statistische Daten über die Austauschhäufigkeit von Aminosäuren sammelte Datensatz von eng verwandten Proteinsequenzen (> 85% Identität). Diese können zweifelsfrei aligniert werden. Aus der Frequenz, mit der Austausche auftreten, wurde die 20 x 20 Matrix für die Wahrscheinlichkeiten aufgestellt, mit der Mutationen eintreten. Diese Matrize heisst PAM 1. Ein evolutionärer Abstand von 1 PAM (point accepted mutation) bedeutet, dass es 1 Punktmutation pro 100 Residuen gibt, bzw. Dass die beiden Sequenzen zu 99% identisch sind. Possibly the most widely used scheme for scoring amino acid pairs is that developed by Dayhoff and co-workers. The system arose out of a general model for the evolution of proteins. 1978!!!, 1572 changes in 71 groups of closely related proteins. Atlas of Protein Sequences. Dataset of 71 aligned sequences? Newer PAM matrices do not differ greatly from the original ones Dayhoff and co workers examined alignments of closely similar sequences where the the likelihood of a particular mutation (e. A-D) being the result of a set of successive mutations (eg. A-x-y-D) was low. Since relatively few families were considered, the resulting matrix of accepted point mutations included a large number of entries equal to 0 or 1. A complete picture of the mutation process including those amino acids which did not change was determined by calculating the average ratio of the number of changes a particular amino acid type underwent to the total number of amino acids of that type present in the database. for example after 2 PAM (Percentage of Acceptable point Mutations per 10^8 years). An evolutionary distance of 1 PAM means there has been 1 point mutation per 100 residues (percent accepted mutation?) 1 PAM corresponds to an average change in 1% of all amino acids positions. Take a list of aligned proteins every time you see a substitution between two amino acids, increment the similarity score betweent them must normalize it by how often amino acids occur in general. Rare amino acids will give rare substitutions PAM model of molecular evolution After 100 PAMs of evolution, not every residue will have changed: some will have mutated several times, perhaps returning to their original state, and others not at all. Note that there is no general correspondence between PAM distance and evolutionary time, as different protein families evolve at different rates. The probabilities represent the average mutational change that will take place when 1 residue out of 100 undergo mutation = 1 PAM (Point Accepted Mutation). 2 sequences 1 PAM apart have 99% identical residues

19 Dayhoff Matrix (2) Log odds Matrix: enthält den Logarithmus der Elemente der PAM Matrizen. Score der Mutation i  j beobachtete Mutationsrate i  j = log( ) aufgrund der Aminosäurefrequenz erwartete Mutationsrate Die Wkt zweier unabhängiger Mutationsereignisse ist das Produkt der Einzelwahrscheinlichkeiten. Bei Verwendung einer log odds Matrix (d.h. bei Verwendung der logarithmisierten Werte) erhält man den gesamten Score des Alignments als Summe der Scores für jedes Residuenpaar.

20 Dayhoff Matrix (3) Aus PAM 1 kann man Matrizen für grössere evolutionäre Entfernungen herstellen indem man die Matrix mehrfach mit sich selbst multipliziert. PAM250: 2,5 Mutationen pro Residue entspricht 20% Treffern zwischen zwei Sequenzen, d.h. man beobachtet Änderungen in 80% der Aminosäurepositionen. Dies ist die Default-Matrize in vielen Sequenzanalysepaketen. 2 PAM = 108 jaar?? Opzoeken…. However, in principle, it is more effective to use a matrix that corresponds to the actual evolutionary distance between the sequences being compared PAM250: approximately 80 % of the amino acid positions are observed to have changed. Rule of thumb PAM 1 = 1 million year PAM 10: on diagonal S=7 W=13 Man vs gorilla on avg 1-2 aa different Je kunt niets zeggen over uitwisselingen PAM 85: on diagnoal 4-13 Man & horse? PAM 250 dit is ongeveer hoe verje kunt gaan, daarna vgl je mens met slime mold Take powers of this matrix PAM1 PAM250 corresponds to ca. 20% overall sequence identity, is the lowest sequence seq sim for which we can hope to produce a correct alignment by sequence analysis alone.

21 BLOSUM Matrix Einschränkung der Dayhoff-Matrix:
Die Matrizen, die auf dem Dayhoff-Modell der evolutionären Raten basieren, sind von eingeschränktem Wert, da ihre Substitionsraten von Sequenzalignments abgeleitet wurden, die zu über 85% identisch sind. Ein anderer Weg wurde von S. Henikoff und J.G. Henikoff eingeschlagen, welche lokale multiple Alignments von entfernter verwandten Sequenzen verwendeten. Ihre Vorteile: grössere Datenmengen multiple Alignments sind robuster NO EXTRAPOLATION NECESSARY They examine multiple alignments of distantly related proteins directly, rather than extrapolate from closely related sequences. Advantage: it cleaves closer to observation; a disadvantage is that it yields no evolutionary model. A number of tests suggest that the BLOSUM matrices produced by this method are generally superior to thte PAM matrices for detecting biological relationships.

22 BLOSUM Matrix (2) Die BLOSUM Matrizen (BLOcks SUbstitution Matrix) basieren auf der BLOCKS Datenbank. Die BLOCKS Datenbank verwendet das Konzept von Blöcken (lückenlose Aminosäure-Signaturen), die charakteristisch für eine Proteinfamilie sind. Aus den beobacheten Mutationen innerhalb dieser Blöcke wurden Austauschwahrscheinlichkeiten für alle Aminosäurepaare berechnet und für eine log odds BLOSUM matrix benutzt. Man erhält unterschiedliche Matrizen indem man die untere Schranke des verlangten Grads an Identität variiert. z.B. wurde die BLOSUM80 Matrix aus Blöcken mit > 80% Identität abgeleitet. . Built only form the most conserved domains of the blocks database of conserved proteins. Dataset: 2000 blocks of aligned sequence … segments characterizing more than 500 groups of related proteins (1992)

23 Welche Matrix soll man benutzen?
Enge Verwandtschaft (Niedrige PAM, hohe Blosum) Entfernte Verwandtschaft (Hohe PAM, niedrige Blosum) Vernünftige Default-Werte: PAM250, BLOSUM62 At the level of 2,000 PAM Schwartz and Dayhoff suggest that all the information present in the matrix has degenerated except that the matrix element for Cys-Cys is 10% higher than would be expected by chance. At the evolutionary distance of 256 PAMs one amino acid in five remains unchanged but the amino acids vary in their mutability; 48% of the tryptophans, 41% of the cysteines and 20% of the histidines would be unchanged, but only 7% of serines would remain.

24 Gewichtung von Lücken (Gaps)
Neben der Substitutionsmatrix braucht man auch eine Methode zur Bewertung von Lücken. Welche Bedeutung haben Insertionen und Deletionen im Verhältnis zu Substitutionen? Unterscheide Einführung von Lücken: aaagaaa aaa-aaa von der Erweiterung von Lücken: aaaggggaaa aaa----aaa Verschiedene Programme (CLUSTAL-W, BLAST, FASTA) empfehlen unterschiedliche Default-Werte, die man wohl erst einmal verwenden sollte. At the level of 2,000 PAM Schwartz and Dayhoff suggest that all the information present in the matrix has degenerated except that the matrix element for Cys-Cys is 10% higher than would be expected by chance. At the evolutionary distance of 256 PAMs one amino acid in five remains unchanged but the amino acids vary in their mutability; 48% of the tryptophans, 41% of the cysteines and 20% of the histidines would be unchanged, but only 7% of serines would remain.

25 Needleman-Wunsch Algorithmus
- allgemeiner Algorithmus für Sequenzvergleiche - maximiert einen Ähnlichkeitsscore - bester Match = grösste Anzahl an Residuen einer Sequenz, die zu denen einer anderen Sequenz passen, wobei Deletionen erlaubt sind. - Der Algorithmus findet durch dynamische Programmierung das bestmögliche GLOBALE Alignment zweier beliebiger Sequenzen - NW beinhaltet eine iterative Matrizendarstellung alle möglichen Residuenpaare (Basen oder Aminosäuren) – je eine von jeder Sequenz – werden in einem zwei-dimensionalen Gitter dargestellt. alle möglichen Alignments werden durch Pfade durch dieses Gitter dargestellt. - Der Algorithmus hat 3 Schritte: 1 Initialisierung 2 Auffüllen 3 Trace-back What database sequences are most similar to (or contain the most similar regions to) my previously uncharacterised sequence? Searching a data base needs to be fast and sensitive but the two objectives counteract each other and has a high sensitivity for detecting distant sequence relationships between a query sequence and a database. Input=seq Output= list of seq that match query sequence

26 Needleman-Wunsch Algorithm: Initialisierung
Aufgabe: aligniere die Wörter “COELACANTH” und “PELICAN” der Länge m =10 und n =7. Konstruiere (m+1)  (n+1) Matrix. Ordne den Elementen der ersten Zeile und Reihe die Werte – m  gap und – n  gap zu. Die Pointer dieser Felder zeigen zurück zum Ursprung. C O E L A N T H -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 P I What database sequences are most similar to (or contain the most similar regions to) my previously uncharacterised sequence? Searching a data base needs to be fast and sensitive but the two objectives counteract each other and has a high sensitivity for detecting distant sequence relationships between a query sequence and a database. Input=seq Output= list of seq that match query sequence

27 Needleman-Wunsch Algorithm: Auffüllen
Fülle alle Matrizenfelder mit Werten und Zeigern gemäss von simplen Operationen, die die Werte der diagonalen, vertikal, und horizontalen Nachbarzellen einschliessen. Berechne match score: Wert der Diagonalzelle links oben + Wert des Alignments (+1 oder -1) horizontal gap score: Wert der linken Zelle + gap score (-1) vertical gap score: Wert der oberen Zelle + gap score (-1) ordne der Zelle das Maximum dieser 3 Werte zu. Der Pointer zeigt in Richtung des maximalen Scores. max(-1, -2, -2) = -1 max(-2, -2, -3) = -2 (Pointer soll bei gleichen Werte immer in eine bestimmte Richtung zeigen, z.B. entlang der Diagonalen. C O E L A N T H -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 P What database sequences are most similar to (or contain the most similar regions to) my previously uncharacterised sequence? Searching a data base needs to be fast and sensitive but the two objectives counteract each other and has a high sensitivity for detecting distant sequence relationships between a query sequence and a database. Input=seq Output= list of seq that match query sequence

28 Needleman-Wunsch Algorithmus: Trace-back
Trace-back ergibt das Alignment aus der Matrix. Starte in Ecke rechts unten und folge den Pfeilen bis in die Ecke links oben. COELACANTH -PELICAN-- C O E L A N T H -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 P I 1 2 What database sequences are most similar to (or contain the most similar regions to) my previously uncharacterised sequence? Searching a data base needs to be fast and sensitive but the two objectives counteract each other and has a high sensitivity for detecting distant sequence relationships between a query sequence and a database. Input=seq Output= list of seq that match query sequence

29 Smith-Waterman-Algorithmus
Smith-Waterman ist ein lokaler Alignment-Algorithmus. SW ist eine sehr einfache Modifikation von Needleman-Wunsch. Lediglich 3 Änderungen: die Matrixränder werden auf 0 statt auf ansteigende Gap-Penalties gesetzt. der maximale Wert sinkt nie unter 0. Pointer werden nur für Werte grösser als 0 eingezeichnet. Trace-back beginnt am grösseten Wert der Matrix und endet bei dem Wert 0. ELACAN ELICAN C O E L A N T H P 1 2 I 3 4 What database sequences are most similar to (or contain the most similar regions to) my previously uncharacterised sequence? Searching a data base needs to be fast and sensitive but the two objectives counteract each other and has a high sensitivity for detecting distant sequence relationships between a query sequence and a database. Input=seq Output= list of seq that match query sequence

30 BLAST – Basic Local Alignment Search Tool
Findet das am besten bewertete lokale optimale Alignment einer Testsequenz mit allen Sequenzen einer Datenbank. Sehr schneller Algorithmus, 50 mal schneller als dynamische Programmierung. Kann verwendet werden um sehr grosse Datenbanken zu durchsuchen, da BLAST eine vor-indizierte Datenbank benutzt Ist ausreichend sensititv und selektiv für die meisten Zwecke Ist robust – man kann üblicherweise die Default-Parameter verwenden What database sequences are most similar to (or contain the most similar regions to) my previously uncharacterised sequence? Searching a data base needs to be fast and sensitive but the two objectives counteract each other and has a high sensitivity for detecting distant sequence relationships between a query sequence and a database. Input=seq Output= list of seq that match query sequence

31 BLAST Algorithmus, Schritt 1
Für ein gegebenes Wort der Länge w (gewöhnlich 3 für Proteine) und eine gegebene Score-Matrix Erzeuge eine Liste aller Worte (w-mers), die einen Score > T erhalten, wenn man sie mit dem w-mer der Eingabe vergleicht P Q A 12 P Q N 12 etc. unterhalb Schranke (T=13) Test Sequenz L N K C K T P Q G Q R L V N Q P Q G 18 P E G 15 P R G 14 P K G 14 P N G 13 benachbarte Wörter Wort P M G 13 P D G 13

32 BLAST Algorithmus, Schritt 2
jedes benachbarte Wort ergibt alle Positionen in der Datenbank, in denen es gefunden wird (hit list). P D G 13 P Q G 18 P E G 15 P R G 14 P K G 14 P N G 13 P M G 13 PMG Database

33 Traditional BLAST programs
Search Space Sequence 2 Alignments Gapped alignments Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches. Sequence 1

34 Seeding Sequence 2 Sequence 1
Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches. Word hits Sequence 1

35 Neighboorhood for 3-letter words
BLOSUM62 PAM200 Word Score Word Score RGD 17 RGD 18 KGD 14 RGE 17 QGD 13 RGN 16 RGE 13 KGD 15 EGD 12 RGQ 15 HGD 12 KGE 14 NGD 12 HGD 13 RGN 12 KGN 13 AGD 11 RAD 13 MGD 11 RGA 13 RAD 11 RGG 13 RGQ 11 RGH 13 RGS 11 RGK 13 RND 11 RGS 13 RSD 11 RGT 13 SGD 11 RSD 13 TGD 11 WGD 13 Choice of cut-off T will affect seeding

36 Seeding Sequence 2 Sequence 1
Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches. Sequence 1 Word clusters Isolated words

37 BLAST Algorithm: Extension
Program tries to extend seeds in both directions by adding residue pairs until the added score is smaller than a cut-off. After terminating the extension, the alignment is trimmed back to that with the maximal score.

38 PSI-BLAST “Position-Specific Iterated BLAST”
Entfernte Verwandtschaften lassen sich besser durch Motiv- oder Profil-Suchen entdecken als durch paarweise Vergleiche PSI-BLAST führt zunächst eine BLAST-Suche mit Gaps durch. Das PSI-BLAST Programm verwendet die Information jedes signifikanten Alignments um eine positionsspezifische Substitionsmatrix zu konstruieren, die an Stelle der Eingabesequenz in der nächsten Runde der Datenbank-Suche verwendet wird. PSI-BLAST kann iterativ verwendet werden bis keine neuen signifikanten Alignments mehr gefunden werden. No further details given here. Needed in cases of low homology, when no clear significant hits can be found Distant relationships are often best detected by motif or profile searches rather than pairwise comparisons PSI-BLAST searches are iterated, with a position-specific matrix generated from significant alignments found in round i used in round i + 1. BLAST uses a generalized matrix May not be as sensitive as motif search but is very general and easy to use.

39 BLAST Output (2) Kleine Wahrscheinlichkeit deutet an, dass der Treffer wohl nicht zufällig zustande kam.

40 Bedeutung des Alignments in BLAST
P-Wert (Wahrscheinlichkeit) Gibt die Wahrscheinlichkeit an, mit der der Score eines Alignments zufällig zustande kommen kann. Je näher P bei Null liegt, desto grösser die Sicherheit, dass ein gefundener Treffer ein richtiger Treffer (homologe Sequenz) ist. E-Wert (Erwartungswert) E = P * Anzahl der Sequenzen in Datenbank E entspricht der Anzahl an Alignments eines bestimmten Scores, die man zufällig in einer Sequenz-Datenbank dieser Grösse erwartet (wird z.B. für ein Sequenzalignment E=10 angegeben, erwartet man 10 zufällige Treffer mit dem gleichen Score). Dieses Alignment ist also nicht signifikant. Treffer werden in BLAST nur ausgegeben, wenn der E-Wert unterhalb einer Schranke liegt. The Expect value (E) is a parameter that describes the number of hits one can "expect" to see just by chance when searching a database of a particular size. It decreases exponentially with the Score (S) that is assigned to a match between two sequences. Essentially, the E value describes the random background noise that exists for matches between sequences. In BLAST 2.0, the Expect value is also used instead of the P value (probability) to report the significance of matches. For example, an E value of 1 assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see 1 match with a similar score simply by chance. E= The Expect value is used as a convenient way to create a significance threshold for reporting results. When the Expect value is increased from the default value of 10, a larger list with more low-scoring hits can be reported. P = probability that the HSP was generated as a chance alignment. Orthologs will have extremely significant scores DNA , protein 10-30 Closely related paralogs will have significant scores Protein 10-15 Distantly related homologs may be hard to identify Protein 10-4 Orthologs: the sequences have diverged by speciations -E.g. human, mouse and chicken  hemoglobin Paralogs: the sequences have diverged by gene duplication -E.g. the  and  hemoglobin genes

41 Grobe Anhaltspunkte P-Wert (Wahrscheinlichkeit) – A. M. Lesk
P  genaue Übereinstimmung P zwischen und nahezu identische Sequenzen, zum Beispiel Allele oder SNPs P zwischen und eng verwandte Sequenzen, Homologie gesichert P zwischen und 10-1 in der Regel entfernte Verwandte P > Ähnlichkeit vermutlich nicht signifikant E-Wert (Erwartungswert) E  0,02 Sequenzen vermutlich homolog E zwischen 0,02 und 1 Homologie ist nicht auszuschliessen E  1 man muss damit rechnen, dass diese gute Übereinstimmung Zufall ist. The Expect value (E) is a parameter that describes the number of hits one can "expect" to see just by chance when searching a database of a particular size. It decreases exponentially with the Score (S) that is assigned to a match between two sequences. Essentially, the E value describes the random background noise that exists for matches between sequences. In BLAST 2.0, the Expect value is also used instead of the P value (probability) to report the significance of matches. For example, an E value of 1 assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see 1 match with a similar score simply by chance. E= The Expect value is used as a convenient way to create a significance threshold for reporting results. When the Expect value is increased from the default value of 10, a larger list with more low-scoring hits can be reported. P = probability that the HSP was generated as a chance alignment. Orthologs will have extremely significant scores DNA , protein 10-30 Closely related paralogs will have significant scores Protein 10-15 Distantly related homologs may be hard to identify Protein 10-4 Orthologs: the sequences have diverged by speciations -E.g. human, mouse and chicken  hemoglobin Paralogs: the sequences have diverged by gene duplication -E.g. the  and  hemoglobin genes

42 Tips für den Einsatz von BLAST
Verwende nicht stur die Standardparameter “You get what you look for”. Führe Kontrollen durch, besonders in der twilight zone. z.B. Schüttle die Sequenz durcheinander und wiederhole die Suche. Falls die variierte Sequenz ähnliche Ergebnisse liefert, beruht das Alignment auf einer systematischen Verfälschung, oder die Parameter sind nicht empfindlich genug gewählt Setze Komplexitätsfilter ein wenn erforderlich. Maskiere Repeats in genomischer DNA. Teile große Genomsequenzen in Stücke auf um die Suche zu beschleunigen. Database similarity searches is one of the first and most important steps in analysing a new sequence. If your unknown sequence has a similar copy already in the databases, a search will quickly reveal this fact and if the copy is well annotated you need go little further in trying to identify your sequence. Database searches usually provide the first clues of whether the sequence belongs to an already studied and well known protein family. If there is a similarity to a sequence that is from another species, then they may be homologous (i.e. sequences that descended from a common ancestral sequence). Knowing the function of a similar/homologous sequence will often give a good indication of the identity of the unknown sequence. N.B. You should bear in mind that in order to identify homologous sequences, searches should be made at the protein sequence level, because it is about 5 times more sensitive at finding matches.

43 Zusammenfassung Paarweises Sequenzalignment ist heute Routine, aber nicht trivial. Mit dynamischer Programmierung (z.B. Smith-Waterman) findet man garantiert das Alignment mit optimaler Bewertung. Vorsicht: die Bewertungsfunktion ist nur ein Modell der biologischen Evolution. FASTA ist erheblich schneller als dynamische Programmierung. Am schnellsten ist BLAST und seine Derivate. Beide geben sehr robuste und brauchbare Ergebnisse für Proteinsequenzen. FASTA ist für Nukleotidsequenzen zuverlässiger. Multiple Sequenzalignments sind in der Lage, entferntere Ähnlichkeiten aufzuspüren und bieten ein besseres funktionelles Verständnis von Sequenzen und ihren Beziehungen Kommt nächste Woche dran.

44 V3 Multiples Sequenz Alignment
Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel heute aus Buch von Arthur Lesk

45 Protein-Alignment kann durch tertiäre Strukturinformationen geführt werden
Escherichia coli DjlA protein Homo sapiens DjlA protein nur so kann man letztlich auch bewerten, ob ein Sequenzalignment korrekt ist.

46 Definition von “Homologie”
Homologie: Ähnlichkeit, die durch Abstammung von einem gemeinsamen Ursprungsgen herrührt – die Identifizierung und Analyse von Homologien ist eine zentrale Aufgabe der Phylogenie. Ein Alignment ist eine Hypothese für die positionelle Homologie zwischen Basenpaaren bzw. Aminosäuren.

47 MSA für Thioredoxin-Familie
Farbe Aminosäuretyp Aminosäuren gelb klein, wenig polar Gly, Ala, Ser, Thr grün hydrophob Cys, Val, Ile, Leu Pro, Phe, Tyr, Met, Trp violett polar Asn, Gln, His rot negativ geladen Asp, Glu blau positiv geladen Lys, Arg

48 Infos aus MSA von Thioredoxin-Familie
Thioredoxin: aus 5 beta-Strängen bestehendes beta-Faltblatt, das auf beiden Seiten von alpha-Helices flankiert ist. gemeinsamer Mechanismus: Reduktion von Disulfidbrücken in Proteinen

49 Infos aus MSA von Thioredoxin-Familie
1) Die am stärksten konservierten Abschnitte entsprechen wahrscheinlich dem aktiven Zentrum. Disulfidbrücke zwischen Cys32 und Cys35 gehört zu dem konservierten WCGPC[K oder R] Motiv. Andere konservierte Sequenzabschnitte, z.B. Pro76Thr77 und Gly92Gly93 sind an der Substratbindung beteiligt.

50 Infos aus MSA von Thioredoxin-Familie
2) Abschnitte mit vielen Insertionen und Deletionen entsprechen vermutlich Schleifen an der Oberfläche. Eine Position mit einem konservierten Gly oder Pro läßt auf eine Wendung der Kette (‚turn‘) schließen.

51 Infos aus MSA von Thioredoxin-Familie
3) Ein konserviertes Muster hydrophober Bausteine mit dem Abstand 2 (d.h., an jeder zweiten Position), bei dem die dazwischenliegenden Bausteine vielfältiger sind und auch hydrophil sein können, läßt auf ein -Faltblatt an der Moleküloberfläche schließen.

52 Infos aus MSA von Thioredoxin-Familie
4) Ein konserviertes Muster hydrophober Aminosäurereste mit dem Abstand von ungefähr 4 läßt auf eine -Helix schließen.

53 Infos aus MSA von Thioredoxin-Familie
Die Thioredoxine sind Teil einer Superfamilie, zu der auch viele weiter entfernte homologe Protein gehören, z.B. Glutaredoxin (Wasserstoffdonor für die Reduktion von Ribonukleotiden bei der DNA-Synthese) Protein-Disulfidisomerase (katalysiert bei der Proteinfaltung den Austausch falsch gefalteter Disulfidbrücken) Phosducin (Regulator in G-Protein-abhängigen Signalübertragungswegen) Glutathion-S-Transferasen (Proteine der chemischen Abwehr). Die Tabelle des MSAs für Thioredoxinsequenzen enthält implizit auch Muster, die man zur Identifizierung dieser entfernteren Verwandten nutzen kann.

54 Multiples Sequenz-Alignment - Methoden
Es gibt im wesentlichen 3 unterschiedliche Vorgehensweisen: (1) Manuell (2) Automatisch (3) Kombiniert manuelles Alignment bietet sich an falls Alignment einfach ist. es zusätzliche (strukturelle) Information gibt. automatische Alignment –Methoden in lokalen Minima feststecken. ein automatisch erzeugtes Alignment manuell “verbessert” werden kann.

55 multiples Sequenzalignment
2 Methoden: Dynamische Programmierung betrache 2 Proteinsequenzen von 100 Aminosäuren Länge. wenn es 1002 Sekunden dauert, diese beiden Sequenzen erschöpfend zu alignieren, dann wird es 1003 Sekunden dauern um 3 Sequenzen zu alignieren, 1004 Sekunden für 4 sequences und x1034 Jahre für 20 Sequenzen. Progressives Alignment

56 dynamische Programmierung mit MSA Programm
berechne zunächst paarweise Alignments für 3 Sequenzen wird Würfel aufgespannt: D.h. dynamische Programmierung hat nun Komplexität n1 * n2 * n3 mit den Sequenzlängen n1, n2, n3. Sehr aufwändig! Versuche, Suchraum einzuschränken.

57 dynamische Programmierung mit MSA Programm
Links: Baum für 5 Sequenzen ohne Paarung von Sequenzen. Neighbour-joining Methode: berechne Summe aller Kantenlängen S = a + b + c + d + e (Kantenlängen sind bekannt) In diesem Fall seien sich A und B am nächsten. Konstruiere daher den Baum rechts. Generell: Verbinde die Sequenzpaare mit den kürzesten Abständen …  Man erhält den Baum mit der kleinsten Summe der Kantenlängen. Konstruiere anhand phylogenetischem Baum ein versuchsweises Multiples Sequenz Alignment.

58 dynamische Programmierung mit MSA Programm
Dieses Alignment dient dazu, den möglichen Raum inmitten des Würfels einzugrenzen, in dem das beste MSA zu finden sein sollte. Grosse Rechenersparnis!

59 Progressives Alignment
wurde von Feng & Doolittle 1987 vorgestellt ist eigentlich eine heuristische Methode. Daher ist nicht garantiert, das “optimale” Alignment zu finden. benötigt (n-1) + (n-2) + (n-3) ... (n-n+1) paarweise Sequenzalignments als Ausgangspunkt. weitverbreitete Implementation in Clustal (Des Higgins) ClustalW ist eine neuere Version, in der den Parameter für Sequenzen und Programm Gewichte (weights) zugeteilt werden.

60 Überblick der ClustalW Prozedur
Hbb_Human 1 - CLUSTAL W Hbb_Horse Hba_Human Hba_Horse Myg_Whale Schnelle paarweise Alignments: berechne Matrix der Abstände Hbb_Human 2 3 4 Hbb_Horse Hba_Human 1 Nachbar-Verbindungs- Baumdiagramm Hba_Horse Myg_Whale alpha-helices 1 PEEKSAVTALWGKVN--VDEVGG 2 3 4 2 GEEKAAVLALWDKVN--EEEVGG 3 PADKTNVKAAWGKVGAHAGEYGA progressive Alignments entsprechend dem Baumdiagramm 1 4 AADKTNVKAAWSKVGGHAGEYGA 5 EHEWQLVLHVWAKVEADVAGHGQ

61 ClustalW- Paarweise Alignments
Berechne alle möglichen paarweisen Alignments von Sequenzpaaren. Es gibt (n-1)+(n-2)...(n-n+1) Möglichkeiten. Berechne aus diesen isolierten paarweisen Alignments den “Abstand” zwischen jedem Sequenzpaar. Erstelle eine Abstandsmatrix. aus den paarweisen Distanzen wird ein Nachbarschafts-Baum erstellt Dieser Baum gibt die Reihenfolge an, in der das progressive Alignment ausgeführt werden wird.

62 Multiples Alignment - Erstes Paar
aligniere die beiden ähnlichsten Sequenzen zuerst. dieses Alignment ist dann “fest” und wird nicht mehr angetastet. Falls später ein GAP eingeführt werden muss, wird er in beiden Sequenzen an der gleichen Stelle eingeführt. Deren relatives Alignment bleibt unverändert. Vorteil: Geschwindigkeit. Nachteile: keine objektive Funktion. Keine Möglichkeit zu quantifizieren ob Alignment gut oder schlecht ist. Keine Möglichkeit festzustellen, ob das Alignment “korrekt” ist.

63 ClustalW - Lokales Minimum
Mögliche Probleme: in ein lokales Minimum zu geraten. Falls zu einem frühen Zeitpunkt ein Fehler im Alignment eingebaut wird, kann dieser später nicht mehr korrigiert werden. Zufälliges Alignment.

64 Genauigkeit des Alignments verbessern
Sollen all Sequenzen gleich behandelt werden? Obwohl manche Sequenzen eng verwandt und andere entfernt verwandt sind? Sollen alle Positionen der Sequenzen gleich behandelt werden? Obwohl sie unterschiedliche Funktionen und Positionen in der dreidimensionalen Strukturen haben können?

65 ClustalW- Besonderheiten
Sequenzgewichtung Variable Substitutionsmatrizen Residuen-spezifische Gap-Penalties und verringerte Penalties in hydrophilen Regionen (externe Regionen von Proteinsequenzen), bevorzugt Gaps in Loops anstatt im Proteinkern. Positionen in frühen Alignments, an denen Gaps geöffnet wurden, erhalten lokal reduzierte Gap Penalties um in späteren Alignments Gaps an den gleichen Stellen zu bevorzugen

66 ClustalW- vom Benutzer festzulegende Parameter
Zwei Parameter sind festzulegen (es gibt Default-Werte, aber man sollte sich bewusst sein, dass diese abgeändert werden können): Die GOP- Gap Opening Penalty ist aufzubringen um eine Lücke in einem Alignment zu erzeugen Die GEP- Gap Extension Penalty ist aufzubringen um diese Lücke um eine Position zu verlängern.

67 Positions-spezifische Gap penalties
Bevor irgendein Sequenzpaar aligniert wird, wird eine Tabelle von GOPs erstellt für jede Position der beiden Sequenzen. Die GOP werden positions-spezifisch behandelt und können über die Sequenzlänge variieren. Falls ein GAP an einer Position existiert, werden die GOP und GEP penalties herabgesetzt – und alle anderen Regeln treffen nicht zu. Daher wird die Bildung von Gaps an Positionen wahrscheinlicher, an denen bereits Gaps existieren.

68 Vermeide zu viele Gaps Solange kein GAP offen ist, wird GOP hochgesetzt falls die Position innerhalb von 8 Residuen von einem bestehenden Gap liegt. Dadurch werden Gaps vermieden, die zu eng beieinander liegen. An jeder Position innerhalb einer Reihe von hydrophilen Residuen wird GOP herabgesetzt, da diese gewöhnlich in Loop-Regionen von Proteinstrukturen liegen. Eine Reihe von 5 hydrophilen Residuen gilt als hydrophiler stretch. Die üblichen hydrophilen Residuen sind: D Asp K Lys P Pro E Glu N Asn R Arg G Gly Q Gln S Ser Dies kann durch den Benutzer geändert werden.

69 Tips für progressives Alignment
Progressives Alignment ist ein mathematischer Vorgang, der völlig unabhängig von der biologischen Realität abläuft. Es kann eine sehr gute Abschätzung sein. Es kann eine unglaublich schlechte Abschätzung sein. Erfordert Input und Erfahrung des Benutzers. Sollte mit Vorsicht verwendet werden. Kann (gewöhnlich) manuell verbessert werden. Es hilft oft, farbliche Darstellungen zu wählen. Je nach Einsatzgebiet sollte der Benutzer in der Lage sein, die zuverlässigen Regionen des Alignments zu beurteilen. Für phylogenetische Rekonstruktionen sollte man nur die Positionen verwenden, für die eine zweifelsfreie Hypothese über positionelle Homologie vorliegt.

70 Alignment von Protein-kodierenden DNS-Sequenzen
Es macht wenig Sinn, proteinkodierende DNS-Abschnitte zu alignieren! ATGCTGTTAGGG ATGCTCGTAGGG ATGCT-GTTAGGG ATGCTCGT-AGGG Das Ergebnis kann sehr unplausibel sein und entspricht eventuell nicht dem biologischen Prozess. Es ist viel sinnvoller, die Sequenzen in die entsprechenden Proteinsequenzen zu übersetzen, diese zu alignieren und dann in den DNS-Sequenzen an den Stellen Gaps einzufügen, an denen sie im Aminosäure-Alignment zu finden sind.

71 Zusammenfasusng Progressive Alignments sind die am weitesten verbreitete Methode für multiple Sequenzalignments. Sehr sensitive Methode ebenfalls: Hidden Markov Modelle (HMMer) Multiples Sequenzalignment ist nicht trivial. Manuelle Nacharbeit kann in Einzelfällen das Alignment verbessern. Multiples Sequenzalignment erlaubt Denken in Proteinfamilien und –funktionen.

72 V4 Prediction of Phylogenies based on single genes
Material of this lecture taken from - chapter 6, DW Mount „Bioinformatics“ and from Julian Felsenstein‘s book. A phylogenetic analysis of a family of related nucleic acid or protein sequences is a determination of how the family might have been derived during evolution. Placing the sequences as outer branches on a tree, the evolutionary relationships among the sequences are depicted. Phylogenies, or evolutionary trees, are the basic structures to describe differences between species, and to analyze them statistically. They have been around for over 140 years. Statistical, computational, and algorithmic work on them is ca. 40 years old.

73 3 main approaches in single-gene phylogeny
- maximum parsimony - distance matrix - maximum likelihood (not covered here) Popular programs: PHYLIP (phylogenetic inference package – J Felsenstein) PAUP (phylogenetic analysis using parsimony – Sinauer Assoc

74 Methods for Single-Gene Phylogeny
Choose set of related sequences Obtain multiple sequence alignment Is there strong sequence similarity? Yes Maximum parsimony methods No Yes Is there clearly recogniza-ble sequence similarity? Distance methods No Analyze how well data support prediction Maximum likelihood methods

75 Parsimony methods Edwards & Cavalli-Sforza (1963): that evolutionary tree is to be preferred that involves „the minimum net amount of evolution“.  seek that phylogeny on which, when we reconstruct the evolutionary events leading to our data, there are as few events as possible. (1) We must be able to make a reconstruction of events, involving as few events as possible, for any proposed phylogeny. (2) We must be able to search among all possible phylogenies for the one or ones that minimize the number of events.

76 A simple example Suppose that we have 5 species,
each of which has been scored for 6 characters (0,1) We will allow changes 0  1 and 1  0. The initial state at the root of a tree may be either state 0 or state 1.

77 Evaluating a particular tree
Figure right shows another tree also requiring 8 changes. These two most parsimonious trees are the same tree when the roots of the tree are removed.

78 Methods of rooting the tree
There are many rooted trees, one for each branch of this unrooted tree, and all have the same number of changes of state. The number of changes of state only depends on the unrooted tree, and not at all on where the tree is then rooted. Biologists want to think of trees as rooted  need method to place the root in an otherwise unrooted tree. (1) Outgroup criterion (2) Use a molecular clock.

79 Outgroup criterion Assumes that we know the answer in advance.
Suppose that we have a number of great apes, plus a single old-world monkey. Suppose that we know that the great apes are a monophyletic group. If we infer a tree of these species, we know that the root must be placed on the lineage that connects the old-world monkey (outgroup) to the great apes (ingroup).

80 Molecular clock If an equal amount of changes were observed on all lineages, there should be a point on the tree that has equal amounts of change (branch lengths) from there to all tips. With a molecular clock, it is only the expected amounts of change that are equal. The observed amounts may not be.  using various methods find a root that makes the amounts of change approximately equal on all lineages.

81 Branch lengths Having found an unrooted tree, locate the changes on it and find out how many occur in each of the branches. The location of the changes can be ambiguous.  average over all possible reconstructions of each character for which there is ambiguity in the unrooted tree. Fractional numbers in some branches of left tree add up to (integer) number of changes (right)

82 Open questions * Particularly for larger data sets, need to know how to count number of changes of state by use of an algorithm. * need to know algorithm for reconstructing states at interior nodes of the tree. * need to know how to search among all possible trees for the most parsimonious ones, and how to infer branch lengths. * sofar only considered simple model of 0/1 characters. DNA sequences have 4 states, protein sequences 20 states. * Justification: is it reasonable to use the parsimony criterion? If so, what does it implicitly assume about the biology? * What is the statistical status of finding the most parsimonious tree? Can we make statements how well-supported it is compared to other trees?

83 Counting evolutionary changes
2 related dynamic programming algorithms: Fitch (1971) and Sankoff (1975) - evaluate a phylogeny character by character - for each character, consider it as rooted tree, placing the root wherever seems appropriate. - update some information down a tree; when we reach the bottom, the number of changes of state is available. Do not actually locate changes or reconstruct interior states at the nodes of the tree.

84 Fitch algorithm intended to count the number of changes in a bifurcating tree with nucleotide sequence data, in which any one of the 4 bases (A, C, G, T) can change to any other. At the particular site, we have observed the bases C, A, C, A and G in the 5 species. Give them in the order in which they appear in the tree, left to right.

85 Fitch algorithm For the left two, at the node that is their immediate common ancestor, attempt to construct the intersection of the two sets. But as {C}  {A} =  instead construct the union {C}  {A} = {AC} and count 1 change of state. For the rightmost pair of species, assign common ancestor as {AG}, since {A}  {G} =  and count another .... proceed to bottom Total number of changes = 3. Algorithm works on arbitrarily large trees.

86 Complexity of Fitch algorithm
Fitch algorithm can be carried out in a number of operations that is proportional to the number of species (tips) on the tree. Don‘t we need to multiply this by the number of sites n ? Any site that is invariant (which has the same base in all species, e.g. AAAAA) can be dropped. Other sites with a single variant base (e.g. ATAAA) will only require a single change of state on all trees. These too can be dropped. For sites with the same pattern (e.g. CACAG) that we have already seen, simply use number of changes previously computed. Pattern following same symmetry (e.g. TCTCA = CACAG) need same number of changes  numerical effort rises slower than linearly with the number of sites.

87 Sankoff algorithm Fitch algorithm is very effective – but we can‘t understand why it works. Sankoff algorithm: more complex, but its structure is more apparent. Assume that we have a table of the cost of changes cij between each character state i and each other state j. Compute the total cost of the most parsimonious combinations of events by computing it for each character. For a given character, compute for each node k in the tree a quantity Sk(i). This is interpreted as the minimal cost, given that node k is assigned state i, of all the events upwards from node k in the tree.

88 Sankoff algorithm If we can compute these values for all nodes,
we can also compute them for the bottom node in the tree. Simply choose the minimum of these values which is the desired total cost we seek, the minimum cost of evolution for this character. At the tips of the tree, the S(i) are easy to compute. The cost is 0 if the observed state is state i, and infinite otherwise. If we have observed an ambigous state, the cost is 0 for all states that it could be, and infinite for the rest. Now we just need an algorithm to calculate the S(i) for the immediate common ancestor of two nodes.

89 Sankoff algorithm Suppose that the two descendant nodes are called l and r (for „left“ and „right“). For their immediate common ancestor, node a, we compute The smallest possible cost given that node a is in state i is the cost cij of going from state i to state j in the left descendant lineage, plus the cost Sl(j) of events further up in the subtree gien that node l is in state j. Select value of j that minimizes that sum. Same calculation for right descendant lineage  sum of these two minima is the smallest possible cost for the subtree above node a, given that node a is in state i. Apply equation successively to each node in the tree, working downwards. Finally compute all S0(i) and use previous eq. to find minimum cost for whole tree.

90 Sankoff algorithm The array (6,6,7,8) at the bottom of the tree has a minimum value of 6 = minimum total cost of the tree for this site.

91 Finding the best tree by heuristic search
The obvious method for searching for the most parsimonious tree is to consider ALL trees and evaluate each one. Unfortunately, generally the number of possible trees is too large.  use heuristic search methods that attempt to find the best trees without looking at all possible trees. (1) Make an initial estimate of the tree and make small rearrangements of it = find „neighboring“ trees. (2) If any of these neighbors are better, consider them and continue search.

92 Distance matrix methods
introduced by Cavalli-Sforza & Edwards (1967) and by Fitch & Margoliash (1967) general idea „seems as if it would not work very well“ (Felsenstein): - calculate a measure of the distance between each pair of species - find a tree that predicts the observed set of distances as closely as possible. All information from higher-order combinations of character states is left out. But computer simulation studies show that the amount of lost information is remarkably small. Best way to think about distance matrix methods: consider distances as estimates of the branch length separating that pair of species.

93 Least square method - observed table (matrix) of distances Dij
- any particular tree leads to a predicted set of distances dij.

94 Least square method Measure of the discrepancy between the observed and expected distances: where the weights wij can be differently defined: - wij = 1 (Cavalli&Sforza, 1967) - wij = 1/Dij2 (Fitch&Margoliash, 1967) - wij = 1/Dij (Beyer et al., 1974) Aim: Find tree topology and branch lengths that minimize Q. Equation above is quadratic in branch lengths. Take derivative with respect to branch lengths, set = 0, and solve system of linear equations. Solution will minimize Q. Doug Brutlag‘s course

95 Least square method v2 v1 v5 v6 v7 v4 v3
Number species in alphabetical order. The expected distance between species A and D d14 = v1 + v7 + v4 The expected distance between speices B and E d25 = v5 + v6 + v7 + v2.

96 Finding the least squares tree topology
Now that we are able to assign branch lengths to each tree topology. we need to search among tree topologies. This can be done by the same methods of heuristic search that were presented for the Maximum Parsimony method. Note: no-one has sofar presented a branch-and-bound method for finding the least squares tree exactly. Day (1986) has shown that this problem is NP-complete. The search is not only among tree topologies, but also among branch lengths.

97 neighbor-joining method
introduced by Saitou and Nei (1987) – algorithm works by clustering - does not assume a molecular clock but approximates the „minimum evolution“ model. „Minimum evolution“ model: among possible tree topologies, choose the one with minimal total branch length. Neighbor-joining, as the least-squares method, is guaranteed to recover the true tree if the distance matrix is an exact reflection of the tree.

98 neighbor-joining method
(1) For each tip, compute (2) Choose the i and j for which Dij – ui – uj is smallest. (3) Join items i and j. Compute the branch length from i to the new node (vi) and from j to the new node (vj) as (4) Compute distance between the new node (ij) and each of the remaining tips as (5) Delete tips i and j from the tables and replace them by the new node, (ij), which is now treated as a tip. (6) If more than 2 nodes remain, go back to step (1). Otherwise, connect the two remaining nodes (e.g. l and m) by a branch of length Dlm.

99 limitation of distance methods
Distance matrix methods are the easiest phylogeny method to program, and they are very fast. Distance methods have problems when the evolutionary rates vary largely. One can correct for this in distance methods as well as in likelihood methods. When variation of rates is large, these corrections become important. In likelihood methods, the correction can use information from changes in one part of the tree to inform the correction in others. Once a particular part of the molecule is seen to change rapidly in the primates, this will affect the interpretation of that part of the molecule among the rodents as well. But a distance matrix method is inherently incapable of propagating the information in this way. Once one is looking at changes within rodents, it will forget where changes were seen among primates.

100 V5 – Analyse von Genomsequenzen
- Genom-Assemblierung finde identische k-Tupel - Genom-Alignment Suche nach MUMs (maximal unique matches) andere wichtige Bereiche, für die wir heute keine Zeit haben - Gene identifizieren Hidden Markov Modelle - Transkriptionsfaktorbindestellen Position Specific Scoring Matrices (PSSM) - finde Repeat-Sequenzen Suche nach bekannten Repeat-Motiven Suche auf Suffix-Baum

101 Whole Genome Shotgun Assemblierung
Es gibt 2 Strategien für die Sequenzierung von Genomen: clone-by-clone Methode whole-genome shotgun Methode (Celera, Gene Myers). Die Shotgun Sequenzierung wurde bereits 1977 von F. Sanger et al. eingeführt und ist seither eine Standardmethode für die Sequenzierung von Genen. Umstritten war jedoch, ob man sie auch für komplette Genome verwenden kann. ED Green, Nat Rev Genet 2, 573 (2001)

102 Arachne Programm von Serafin Batzoglou (MIT, Doktorarbeit 2000)
konstruiere Graph G für Überlappungen zwischen Paaren von reads aus Shotgun-Daten prozessiere G um Supercontigs von gemappten reads zu erhalten. Wichtige Variation der whole-genome shotgun Sequenzierung: sequenziere reads jeweils von beiden Enden eines Klons. Da die Inserts nach ihrer Größe ausgewählt werden, ist damit der ungefähre Abstand zwischen dem Paar von reads bekannt. Man nennt diese earmuff (Ohrenwärmer) Verbindungen. Batzoglou et al. Genome Res 12, 177 (2002)

103 Arachne: erzeuge Überlappungsgraphen
Liste von reads R = (r1, ..., rN) , N ist die Anzahl der reads. Jeder read ri besitzt eine Länge li < 1000. Wenn beide reads von den Endpunkten desselben Klons stammen (earmuff link), besitzt ri eine Verknüpfung zu einem anderen read rj in einer festen Distanz dij. Erstes Ziel: erzeuge Graphen G der Überlappungen (Kanten) zwischen Paaren an reads (Knoten)  dies ergibt die Paare an reads in R, die aligniert werden müssen. Da R sehr lang sein kann, sind N2 alignments nicht praktikabel.  erstelle Tabelle für das Vorkommen von k-Tupel (Strings der Länge k) in den reads, zähle die Anzahl von k-Tupel Treffern für jedes Paar an reads. Führe dann paarweise Alignments zwischen den Paaren an reads durch, die mehr als cutoff gemeinsame k-mere besitzen. Batzoglou PhD thesis (2002)

104 Arachne: Tabelle für Vorkommen von k-meren
Ermittle die Anzahl an k-Tupel Treffern in der Vorwärts- und Rückwärts-Richtung zwischen jedem Paar von reads in R. (1) Ermittle alle Triplets (r,t,v) r = Nummer des reads in R t = Index eines k-mers, das in r vorkommt v = Richtung des Auftretens (vorwärts oder rückwärts) (2) sortiere die Menge der Paare nach den k-mer Indices t (3) verwende eine sortierte Liste um eine Tabelle T von Quadrubletts (ri, rj, f, v) zu erstellen, wobei ri und ri die reads sind, die mindestens einen gemeinsamen k-mer enthalten, v die Richtung angiebt, und f die Anzahl an gemeinsamen k-mers zwischen ri und rj in Richtung v. Batzoglou PhD thesis (2002)

105 Arachne: Tabelle für Vorkommen von k-mers
Hier: k = 3 Batzoglou PhD thesis (2002)

106 Arachne: Tabelle für Vorkommen von k-mers
Wenn ein k-Tupel „zu oft“ auftritt  gehört er wahrscheinlich zu einer Repeat-Sequenz. Man sollte diese nicht für die Detektion von Überlappungen verwenden. Implementierung finde k-Tupel (r,t,v) und sortieren sie in 64 Dateien entsprechen den ersten drei Nukleotiden jedes k-mers. Für i=1,64 lade Datei in den Speicher, sortiere nach t, speichere sortierte Datei ab. end lade 64 sortierte Dateien nacheinander in den Speicher, fülle Tabelle T nacheinander auf. In der Praxis ist k = 8 bis 24. Batzoglou PhD thesis (2002)

107 Arachne: paarweise read-Alignments
Führe paarweise Alignments zwischen den Reads durch, die mehr als Cutoff gemeinsame k-mers besitzen. Sobald man zu häufige k-mers ausschließt (mehr als ein zweiter Cutoff), ist sichergestellt, daß nur O(N) viele paarweise Sequenzalignments durchgeführt werden müssen. Nur eine kleine Anzahl an Basen-Austauschen und Indels ist in einer überlappenden Region zweier alignierter reads erlaubt. Output des Alignment-Algorithmus: für die reads ri, rj gibt es Quadrubletts (b1, b2, e1, e2) für jede detektierte Überlappungsregion mit den Anfangspositionen b1, b2 und Endpositionen e1,e2. Falls eine signifikante Überlappungsregion vorliegt, wird (ri, rj, b1, b2, e1, e2) eine Kante im Überlappungsgraphen G. Batzoglou PhD thesis (2002)

108 Kombination teilweiser Alignments
3 teilweise Alignments der Länge k=6 zwischen einem Paar von reads werden zu einem einzigen vollen Alignment der Länge k=19 kombiniert. Die vertikalen Linien verbinden übereinstimmenden Basen, wogegen x Mismatche sind. Dies ist eine oft auftretende Situation, in der ein ausgedehnter k-mer Treffer ein volles Alignment von zwei reads ist. Batzoglou et al. Genome Res 12, 177 (2002)

109 Repeats erzeugen Mehrdeutigkeit
Ohne das Auftreten von Sequen-zierungsfehlern und Repeats wäre es einfach, alle entdeckbaren paarweise Abstände von reads zu finden und den Graph G zu konstruieren. Da es Repeats jedoch sehr häufig auftreten, bedeutet eine Verbindung zwischen zwei reads in G nicht ohne weiteres eine wahre Überlappung. Eine „Repeat-Verbindung“ ist eine Verbindung in G zwischen zwei reads, die aus verschiedenen Regionen des Genoms stammen und in der repetitiven Sequenz überein-stimmen. Batzoglou PhD thesis (2002)

110 Sequence contigs unerläßlich für die Assemblierung ist die ausreichende Überdeckung (mehrfache Sequenzierung = coverage) derselben Genomregionen Batzoglou PhD thesis (2002)

111 Verbinden von Contigs Durch die Löschung von k-mers hoher Frequenz wird einiges an Repetition im Genom vor der Erzeugung von G effizient maskiert. Zur Erkennung von repetitiven Verbindung dienen weitere heuristische Algorithmen, die hier nicht diskutiert werden sollen. Sequenz-Contigs werden gebildet indem Paare von reads verbunden werden, die eindeutig verbunden werden können. Tatsächlich ist die Situation viel schwieriger als hier gezeigt, da Repeats häufig nicht zu 100% zwischen Kopien konserviert sind. Batzoglou PhD thesis (2002)

112 Benutze Überlapp-Paarungen um die reads zu verbinden
Arachne sucht nach 2 Plasmiden mit gleicher Insert-Länge, deren Sequenzen an beiden Enden überlappen  paired pairs. (A) A paired pair of overlaps. The top two reads are end sequences from one insert, and the bottom two reads are end sequences from another. The two overlaps must not imply too large a discrepancy between the insert lengths. (B) Initially, the top two pairs of reads are merged. Then the third pair of reads is merged in, based on having an overlap with one of the top two left reads, an overlap with one of the top two right reads, and consistent insert lengths. The bottom pair is similarly merged. Unten: eine Menge von paired pairs werden zu contigs zusammengefasst und eine Konsensussequenz erzeugt. Batzoglou et al. Genome Res 12, 177 (2002)

113 Detection of repeat contigs
Some of the identified contigs are repeat contigs in which nearly identical sequence from distinct regions are collapsed together. Detection by (a) repeat contigs usually have an unusually high depth of coverage. (b) they will typically have conflicting links to other contigs. Contig R is linked to contigs A and B to the right. The distances estimated between R and A and R and B are such A and B cannot be positioned without substantial overlap between them. If there is no corresponding detected overlap between A and B then R is probably a repeat linking to two unique regions to the right. After marking repeat contigs, the remaining contigs should represent the correctly assembled sequence. Batzoglou et al. Genome Res 12, 177 (2002)

114 Contig assembly If (a,b) and (a,c) overlap, then (b,c) are expected to overlap. Moreover, one can calculate that shift(b,c)=shift(a,c)-shift(a,b). A repeat boundary is detected toward the right of read a, if there is no overlap (b,c), nor any path of reads x1, ..., xk such that (b,x1), (x1,x2) ..., (xk,c) are all overlaps, and shift(b,x1) shift(xk,c)  shift(a,c) – shift(a,b). Batzoglou et al. Genome Res 12, 177 (2002)

115 Consistency of forward-reverse links
The distance d(A,B) (length of gap or negated length of overlap) between two linked contigs A and B can be estimated using the forward-reverse linked reads between them. The distance d(B,C) between two contigs B,C that are linked to the same contig A can be estimated from their respective distances to the linked contig. Batzoglou et al. Genome Res 12, 177 (2002)

116 Filling gaps in supercontigs
Contigs A and B are connected by a path p of contigs X1,..., Xk. The distance dp(A,B) between A and B (along the path p) is the length of the sequence in the path that does not overlap A and B. Contigs Y1 and Y2 share forward-reverse links with the supercontig S. These links position them in the vicinity of the gap between A and B. Therefore, Y1 and Y2 will be used as possible stepping points in the path closing the gap from A to B. Batzoglou et al. Genome Res 12, 177 (2002)

117 Comparison of different assemblers
you should look out for: - smallest number of contigs + misassembled contigs highest possible coverage by contigs lowest possible coverage by misassembled contigs Pevzner, Tang, Waterman PNAS 98, 9748 (2001)

118 Whole Genome Alignment (WGA)
Nachdem die genomische DNA-Sequenz eng verwandter Organismen verfügbar wird, ist die erste Frage, wie das Alignment beider Genome aussieht. Globale Genom-Alignments machen nur für eng verwandte Organismen Sinn. Im anderen Fall muß man erst die genomischen Rearrangements betrachten. Dann kann man die systenischen Regionen (Regionen, in denen Gen-Reihenfolge des nächsten gemeinsamen Vorfahrens in beiden Spezies konserviert blieb) betrachten und lokale Genom-Alignments dieser Regionen produzieren.

119 Vergleich von Maus und Mensch auf Genomebene
aus dem Paper des Mouse Genome Sequencing Consortiums „Initial sequencing and comparative analysis of the mouse genome“, Nature 420, ( ). Excellent paper! Well readable! Wichtigste Ergebnisse: * das Mausgenom ist etwa 14% kürzer als das menschliche Genom. Die unterschiedliche Länge liegt wohl an der höheren Deletionsrate in Maus. * über 90% des Maus- und Menschen-Genoms kann in entsprechende Regionen mit konservierter Syntenie eingeteilt werden * auf dem Nukleotid-Level kann etwa 40% des menschlichen Genoms mit dem Maus-Genom aligniert werden (diese am stärksten orthologen Sequenzen blieben wohl in beiden Linien vom gemeinsamen Vorfahren erhalten). Der Rest wurde wohl in einem oder beiden Genomen gelöscht. * die neutrale Substitutionsrate beträgt etwa 0.5 Nucleotid-Substitutionen pro Position seit der Divergenz der beiden Spezien. Etwa doppelt so viele Austausche haben in Maus gegenüber Mensch stattgefunden.

120 Vergleich von Maus und Mensch auf Genomebene
Key findings: * der Anteil kurzer ( bp) Segmente in den Säugetier-Genomen, der reinigender Selektion unterliegt, ist etwa 5%, d.h. wesentlich höher als der Anteil der Protein-kodierenden Regionen  Genome enthalten viele zusätzliche Eigenschaften wie UTRs (untranslated regions), regulatorische Elemente, nicht-Protein-kodierende Gene, chromosomale Strukturelemente, die unter Selektion für die biologische Funktion stehen. * die Evolution von Säugetier-Genomen verläuft ungleichmäßig. Es gibt deutliche Unterschiede an Divergenz je nach Genomposition. * Sowohl Maus wie Mensch-Genom enthalten etwa Gene, die für Proteine kodieren. Der Anteil an Mausgenen mit einem eindeutigen Orthologen im menschlichen Genom ist etwa 80%. Der Anteil der Mausgene ohne ein homologes Gen im menschlichen Genom ist < 1%.

121 Konservierung von Syntenie zwischen Mensch und Maus
Ein typisches 510-kb Segment des Maus-Chromosoms 12, das mit einem 600-kb Stück des menschlichen Chromosom 14 verwandt ist. Blaue Linien: reziprok eindeutige Treffer in beiden Genomen. Rote Markierungen kennzeichnen die Länge der passenden Regionen. Die Abstände zwischen diesen „Landmarks“ sind im Maus-Genom kleiner als im Mensch, was mit der 14% kürzeren Gesamtlänge des Genoms übereinstimmt. The mouse genome. Nature 420,

122 Entsprechung syntenischer Regionen
342 Segmente und 217 Blöcke >300 kb mit konservierter Syntenie im Mensch sind im Maus-Genom markiert. Jede Farbe entspricht einem bestimmten menschlichen Chromosom. The mouse genome. Nature 420,

123 Sensitivität Im globalen Mensch:Maus Alignment sind mehr als eine Millionen Regionen stärker als 70% konserviert (auf 100-bp Level) – diese Regionen decken > 200 Million bp ab. Nur 62% von ihnen werden von (lokalen) BLAT-Treffern abgedeckt. Dies bedeutet, daß man 38% der konservierten Abschnitte nur durch das globale Alignment finden kann! Idee: lokales Alignment soll als Anker-Verfahren für anschliessendes globales Alignment dienen. Dadurch hofft man, viele zusätzliche konservierte Regionen ausserhalb der Anker-Regionen zu finden. In conclusion, we think MUMmer is a major breakthrough in full genome alignment and MUMmer 2 has made some further improvement in time and space requirements; It is possible to improve the data structure further, for example by using suffix array Also, it is worth noting the the principle of MUMmer has been extended to multiple genome alignment implemented in a program called MGA Couronne, ..., Dubchak, Genome Res. 13, 73 (2003)

124 hohe Sensitivität von globalen Alignments
Beispiel: das globale Alignment der mouse finished sequence NT_ gegen die Region, die mit BLAT-Ankern gefunden wurde, zeigt konservierte kodierende und nicht-kodierende Elemente, die mit BLAT nicht gefunden wurden. In conclusion, we think MUMmer is a major breakthrough in full genome alignment and MUMmer 2 has made some further improvement in time and space requirements; It is possible to improve the data structure further, for example by using suffix array Also, it is worth noting the the principle of MUMmer has been extended to multiple genome alignment implemented in a program called MGA Couronne, ..., Dubchak, Genome Res. 13, 73 (2003)

125 Zusätzliche Informationen aus globalem WGA
Unterschiede in Repeat-Merkmalen Duplikationen (große Fragmente, chromosomal) Tandem-Repeats Große Insertionen und Deletionen Translokationen von einem Teil des Genoms zu einem anderen Single Nucleotide Polymorphism So to remind you the type of information that we can get from whole genome alignment are as follow: Difference in repeat patterns; spe

126 Methods for WGA: iterative pairwise global alignment
These Methods follow a general strategy of iteratively merging two multiple alignments of two disjoint subsets of sequences into a single multiple alignment of the union of those subsets. Construct a hash table on either the query string, or the database string (or both) for all possible substrings of a pre-specified size (say l) Find exactly matching substrings of length l using this hash table (seeds). In the second phase, these seeds are extended in both directions, and combined if possible, in order to find better alignments. If the global pairwise alignment of two genomic DNA sequences S1 and S2 is computed by standard dynamic programming algorithms (which requires O( | S1 |∙| S2 | time, where |S| is the length of sequence S) such iterative methods cannot be used in practice to align DNA sequences of entire genomes due to time and memory limitations. examples are: FASTA, BLAST, MegaBLAST, BL2SEQ, Wu-blast, flash,PipMaker (BLASTZ), and PatternHunter

127 Methods for WGA: anchor-based global multiple alignment
These methods try to identify substrings of the sequences under consideration that they are likely parts of a global alignment. (As mentioned, these substrings can be obtained from local alignments). These substrings form „anchors“ in the sequences to be aligned. These methods first align the anchors and subsequently close the gaps (align the substrings between the anchors). Anchor-based alignment methods are well suited for aligning very long sequences. MUMmer is a very successful implementation of this strategy for aligning two genome sequences.

128 Was ist MUMmer? A.L. Delcher et al. 1999, 2002 Nucleic Acids Res.
Nimm an, dass zwei Sequenzen eng verwandt sind (sehr ähnlich) MUMmer kann zwei bakterielle Genome in weniger als 1 Minute alignieren nutzt Suffix-Bäume um Maximal Unique Matches zu finden Definition eines Maximal Unique Matches (MUM): Eine Subsequenz, die in beiden Sequenzen genau einmal ohne Abweichungen vorkommt und in keine Richtung verlängert werden kann. Grundidee: ein MUM ausreichender Länge wird sicher Teil eines globalen Alignments sein. A maximal unique matching subsequence (MUM) of 39 nt (shown in uppercase) shared by Genome A and Genome B. Any extension of the MUM will result in a mismatch. By definition, an MUM does not occur anywhere else in either genome. Delcher et al. Nucleic Acids Res 27, 2369 (1999)

129 MUMmer: wichtige Schritte
Erkenne MUMs (Länge wird vom Benutzer festgelegt) ACTGATTACGTGAACTGGATCCA ACTCTAGGTGAAGTGATCCA ACTGATTACGTGAACTGGATCCA ACTCTAGGTGAAGTGATCCA 1 10 20 ACTGATTACGTGAACTGGATCCA ACTC--TAGGTGAAGTG-ATCCA 1 10 20

130 Definition von MUMmers
Für zwei Strings S1 und S2 und einen Parameter l Der Substring u ist eine MUM Sequenz wenn gilt: |u| > l u kommt genau einmal in S1 und genau einmal in S2 (Eindeutigkeit) Für jeden Buchstaben a kommt weder ua noch au sowohl in S1 als auch in S2 vor (Maximalität)

131 Wie findet man MUMs? Naiver Ansatz
Vergleiche alle Teilsequenzen von A mit allen Teilsequenzen von B. Dies dauert O(nn) verwende Suffix-Bäume als Datenstruktur ein naiver Ansatz, einen Suffix-Baum zu konstruieren hat eine quadratische Komplexität in der Rechenzeit und dem Speicherplatz durch klevere Benutzung von Pointern gibt es lineare Algorithmen in Rechenzeit und Speicherplatz wie den Algorithmus von McCreight

132 Suffix-Bäume CACATAG$
Suffix-Bäume sind seit über 20 Jahren wohl etabliert. Einige ihrer Eigenschaften: ein “Suffix” beginnt an jeder Position I der Sequenz und reicht bis zu ihrem Ende. Eine Sequenz der Länge N hat N Suffices. Es gibt N Blätter. Jeder interne Knoten hat mindest zwei Kinder. 2 Kanten aus dem selben Knoten können nicht mit dem selben Buchstaben beginnen. Am Ende wird $ angefügt CACATAG$

133 Suchen in einem Suffix-Baum
Search Pattern: CATA $ G $ 8 7 A C T A G $ 4 A C C T A A T G T A T $ A A A G 6 G G G $ $ $ $ 2 3 1 5

134 Suchen in einem Suffix-Baum
Search Pattern: ATCG $ G $ 8 7 A C T A G $ 4 A C C T A A T G T A T $ A A A G 6 G G G $ $ $ $ 2 3 1 5

135 MUMmer 1.0: Wie findet man MUMs?
Konstruiere einen Suffix-Baum aus allen Suffices von Genom A Füge jedes Suffix von Genom B in diesen Suffix-Baum ein Kennzeichne jedes Blatt mit dem Genom, das es enthält

136 Sortieren der MUMs MUMs werden nach ihren Positionen in Genom A sortiert Genome A: 1 2 3 4 5 6 7 Genome B: 3 6 5 1 2 4 7 Genome A: 1 2 4 6 7 Genome B: 6 7 1 2 4 Jeder MUM ist nur mit seiner Nummer gekennzeichnet, ohne Berücksichtigung seiner Länge. Das obere Alignment zeigt alle MUMs. Die Verschiebung von MUM 5 in Genom B zeigt eine Transposition an. Die Verschiebung von MUM 3 könnte ein Zufallstreffer oder Teil einer inexakten Repeat-Sequenz sein. Unteres Alignment: suche in beiden Genomen die längste gemeinsam ansteigende Folge an Subsequenzen

137 Es gibt 4 Arten an Gaps in MUM-Alignments
Diese Beispiele stammen aus dem Alignment der beiden M.tuberculosis Genome. In conclusion, we think MUMmer is a major breakthrough in full genome alignment and MUMmer 2 has made some further improvement in time and space requirements; It is possible to improve the data structure further, for example by using suffix array Also, it is worth noting the the principle of MUMmer has been extended to multiple genome alignment implemented in a program called MGA Delcher et al. Nucleic Acids Res 27, 2369 (1999)

138 Beispiel: Alignment zweier Mikroorganismen
Das Genom von M.genitalium ist nur etwa 2/3 so lang wie das von M.pneumoniae. Obere Abbildung: FASTA-Alignment von M.genitalium und M.pneumoniae. Mitte: Alignment mit 25mers Unten: Alignment mit MUMs. 5 Translokationen. Ein Punkt bedeutet jeweils einen Treffer zwischen den Genomen. FASTA-Plot: ähnliche Gene 25-mer-Plot: 25-Basen-Sequenz, die in beiden Sequenzen genau einmal vorkommt. MUM-Plot: MUM-Treffer. In conclusion, we think MUMmer is a major breakthrough in full genome alignment and MUMmer 2 has made some further improvement in time and space requirements; It is possible to improve the data structure further, for example by using suffix array Also, it is worth noting the the principle of MUMmer has been extended to multiple genome alignment implemented in a program called MGA Delcher et al. Nucleic Acids Res 27, 2369 (1999)

139 Example: alignment human:mouse
Alignment of even more distant species: human and mouse. Here: alignment of a bp subsequence of human chromosome 12p13, accession no. U47924, to a bp subsequence of mouse chromosome 6, accession no. AC Each point in the plot corresponds to an MUM of [ge]15 bp. In conclusion, we think MUMmer is a major breakthrough in full genome alignment and MUMmer 2 has made some further improvement in time and space requirements; It is possible to improve the data structure further, for example by using suffix array Also, it is worth noting the the principle of MUMmer has been extended to multiple genome alignment implemented in a program called MGA Delcher et al. Nucleic Acids Res 27, 2369 (1999)

140 Zusammenfassung Die Anwendung der Suffix-Bäume war ein Durchbruch für die Alignierung ganzer Genome MUMmer 2 besitzt zusätzliche Verbesserung für die Rechenzeit und den Speicherplatz die Verwendung von Suffix-Arrays anstatt von Suffix-Bäumen gibt eine verbesserte Datenstruktur ( Stefan Kurtz, Hamburg) es wird nun möglich, mehr als zwei Genome zu alignieren (implementiert in MGA) In conclusion, we think MUMmer is a major breakthrough in full genome alignment and MUMmer 2 has made some further improvement in time and space requirements; It is possible to improve the data structure further, for example by using suffix array Also, it is worth noting the the principle of MUMmer has been extended to multiple genome alignment implemented in a program called MGA

141 V6: Bioinformatische Analyse von Proteinstrukturen
Angelehnt an Kapitel 1 und 5 aus dem Buch von Arthur Lesk Hierarchischer Aufbau der Proteinstruktur Klassifikation von Proteinstrukturen

142 Funktion von Proteinen
Strukturproteine (Hüllenproteine von Viren, Cytoskelett) Enzyme, die chemische Reaktionen katalysieren Transport- und Speicheproteine (Hämoglobin) Regulatoren wie Hormone und Rezeptoren/Signalübertragungsproteine Proteine, die die Transkription kontrollieren oder an Erkennungsvorgängen beteiligt sind: Zelladhäsionsproteine, Antikörper

143 Warum sind Proteine so groß?
Proteine sind große Moleküle. Ihre Funktion ist oft in einem kleinen Teil der Struktur, dem aktiven Zentrum, lokalisiert. Der Rest? Korrekte Orientierung der Aminosäuren des aktiven Zentrums Bindungsstellen für Interaktionspartner Konformationelle Dynamik Evolution der Proteine: Veränderungen der Struktur, die durch Mutationen in ihrer Aminosäuresequenz hervorgerufen werden.

144 Hierarchischer Aufbau
Primärstruktur – Sekundärstruktur – Tertiärstruktur – Quartärnere Struktur – Komplexe Welche „Kräfte“ sind für die Ausbildung der verschiedenen „Strukturen“ wichtig?

145 Einleitung: Aminosäuren
Aminosäuren sind die Bausteine von Proteinen: Aminogruppe Carboxylsäure Aminosäuren unterscheiden sich hinsichtlich ihrer Größe elektrischen Ladung Polarität Form und Steifigkeit 1

146 Einleitung: hydrophobe Aminosäuren
Proteine sind aus 20 verschiedenen natürlichen Aminosäuren aufgebaut 5 sind hydrophob. Sie sind vor allem Im Proteininneren. 1

147 Einleitung: aromatische Aminosäuren
Es gibt drei voluminöse aromatische Aminosäuren. Tyrosin und Tryptophan liegen bei Membranproteinen vor allem in der Interface-region. 1

148 Einleitung: Aminosäuren
Es gibt 2 Schwefel enthaltende Aminosäuren und das ungewöhnliche Prolin. Cysteine können Disulfidbrücken bilden. Prolin ist ein “Helixbrecher”. 1

149 Einleitung: Aminosäuren
Es gibt zwei Aminosäuren mit terminalen polaren Hydroxlgruppen: 1

150 Einleitung: Aminosäuren
Es gibt 3 positiv geladene Aminosäuren. Sie liegen vor allem auf der Proteinoberflächen und in aktiven Zentren. Thermophile Organismen besitzen besonders viele Ionenpaare auf den Protein-oberflächen. 1

151 Einleitung: Aminosäuren
Es gibt 2 negativ geladene Aminosäuren und ihre zwei neutralen Analoga. Asp und Glu haben pKa Werte von 2.8. Das heisst, erst unterhalb von pH=2.8 werden ihre Carboxylgruppe protoniert. 1

152 Buchstaben-Code der Aminosäuren
Ein- und Drei-Buchstaben-Codes der Aminosäuren G Glycin Gly P Prolin Pro A Alanin Ala V Valin Val L Leucin Leu I Isoleucin Ile M Methionin Met C Cystein Cys F Phenylalanin Phe Y Tyrosin Tyr W Tryptophan Trp H Histidin His K Lysin Lys R Arginin Arg Q Glutamin Gln N Asparagin Asn E Glutaminsäure Glu D Asparaginsäure Asp S Serin Ser T Threonin Thr Zusätzliche Codes B Asn/Asp Z Gln/Glu X Irgendeine Aminosäure Kenntnis dieser Abkürzungen ist essentiell für Sequenzalignments und für Proteinstrukturanalyse!

153 Einleitung: Peptidbindung
In Peptiden und Proteinen sind die Aminosäuren miteinander als lange Ketten verknüpft. Ein Paar ist jeweils über eine „Peptidbindung“ verknüpft. Die Aminosäuresequenz eines Proteins bestimmt seinen „genetischen code“. Die Kenntnis der Sequenz eines Proteins allein verrät noch nicht viel über seine Funktion. Entscheidend ist seine drei-dimensionale Struktur. 1

154 Eigenschaften der Peptidbindung
E.J. Corey und Linus Pauling studierten die Petidbindung in den 1940‘ern und 1950‘ern. Sie fanden: die C-N Länge ist 1.33 Å. Sie liegt damit zwischen 1.52 Å und 1.25 Å, was die Werte für eine Einfach- bzw. Doppelbindung sind. Die benachbarte C=O Bindung hat eine Länge Von 1.24 Å, was etwas länger als eine typische Carbonyl- C=O Doppelbindung ist (1.215 Å). die Peptidbindung hat einen teilweise konjugierten Charakter und ist nicht frei drehbar. Es bleiben damit pro Residue 2 frei drehbare Diederwinkel des Proteinrückgrats übrig. Linus Pauling Nobelpreise für Chemie 1954 und Frieden 1963 1

155 Einleitung: Sekundärstrukturelemente
Wie seit den 1950‘er Jahren bekannt, können Aminosäure-Stränge Sekundärstrukturelemente bilden: (aus Stryer, Biochemistry) -Helices und -Stränge. In diesen Konformationen bilden sich jeweils Wasserstoffbrückenbindungen zwischen den C=O und N-H Atomen des Rückgrats. Daher sind diese Einheiten strukturell stabil. 1

156 Diederwinkel des Proteinrückgrats
Die dreidimensionale Faltung des Proteins wird vor allem durch die Diederwinkel des Proteinrückgrats bestimmt. Pro Residue gibt es 2 frei drehbare Diederwinkel, die als  und  bezeichnet werden. Lesk-Buch

157 Stabilität und Faltung von Proteinen
Die gefaltete Struktur eines Proteins ist die Konformation, die die günstigste freie Enthalpie G für diese Aminosäuresequenz besitzt. Der Ramachandran-Plot charakterisiert die energetisch günstigen Bereiche des Aminosäurerückgrats. -Faltblatt-Region r-Helix-Region (rechtsgängige Helix)

158 Domänen Kompakter Bereich im Faltungsmuster einer Molekülkette,
der den Anschein hat, “er könnte auch unabhängig von den anderen stabil sein”. Lesk-Buch SERCA Calcium-Pumpe cAMP-abhängige Proteinkinase

159 Modular aufgebaute Proteine
Modular aufgebaute Proteine bestehen aus mehreren Domänen. Anwendung von SMART (www.smart.embl-heidelberg.de) für die Src-Kinase HcK ergibt Sequenz: MGGRSSCEDP GCPRDEERAP RMGCMKSKFL QVGGNTFSKT ETSASPHCPV YVPDPTSTIK PGPNSHNSNT PGIREAGSED IIVVALYDYE AIHHEDLSFQ KGDQMVVLEE SGEWWKARSL ATRKEGYIPS NYVARVDSLE TEEWFFKGIS RKDAERQLLA PGNMLGSFMI RDSETTKGSY SLSVRDYDPR QGDTVKHYKI RTLDNGGFYI SPRSTFSTLQ ELVDHYKKGN DGLCQKLSVP CMSSKPQKPW EKDAWEIPRE SLKLEKKLGA GQFGEVWMAT YNKHTKVAVK TMKPGSMSVE AFLAEANVMK TLQHDKLVKL HAVVTKEPIY IITEFMAKGS LLDFLKSDEG SKQPLPKLID FSAQIAEGMA FIEQRNYIHR DLRAANILVS ASLVCKIADF GLARVIEDNE YTAREGAKFP IKWTAPEAIN FGSFTIKSDV WSFGILLMEI VTYGRIPYPG MSNPEVIRAL ERGYRMPRPE NCPEELYNIM MRCWKNRPEE RPTFEYIQSV LDDFYTATES QYQQQP

160 Klassifikation von Proteinen
Die Klassifikation von Proteinstrukturen nimmt in der Bioinformatik eine Schlüsselposition ein, weil sie das Bindeglied zwischen Sequenz und Funktion darstellt. Lesk-Buch

161 Anwendungen der Hydrophobizität
Lesk-Buch

162 Anwendungen der Hydrophobizität: Das helikale Rad
Betrachte die Residuen einer Transmembranhelix … -Helices in globulären Proteinen haben oft eine ins Innere des Proteins weisende „hydrophobe“ Seite und eine „hydrophile“ Seite, die zum Lösungsmittel gerichtet ist. In einer -Helix ist jede Aminosäure um etwa 100 Grad gegenüber ihrem Vorgänger verdreht. Damit müssen sich hydrophile und hydrophobe Residuen etwa alle 4 Positionen abwechseln. Dasselbe Verhalten zeigen amphipatische Helices, die auf der Oberfläche einer Lipid-Doppelschicht binden. 1

163 Topologie von Membranproteinen
Im Inneren der Lipidschicht kann das Proteinrückgrat keine Wasserstoffbrücken- Bindungen mit den Lipiden ausbilden  die Atome des Rückgrats müssen miteinander Wasserstoffbrückenbindungen ausbilden, sie müssen entweder helikale oder -Faltblattkonformation annehmen. 1

164 Topologie von Membranproteinen
Die hydrophobe Umgebung erzwingt, dass (zumindest die bisher bekannten) Strukturen von Transmembranproteinen entweder reine -Barrels (links) oder reine -helikale Bündel (rechts) sind. 1

165 Superposition von Strukturen und Struktur-Alignment
Vergleich von zwei Proteinstrukturen: Angabe des RMS-Werts, die Wurzel der mittleren quadratischen Abweichung, oder root-mean-square deviation Interessanterweise ist bei zwei verschiedenen Proteinen oft nicht klar, welche Atome überlagert werden sollen! di : Abstand zwischen den Koordinaten des i-ten Atompaares n : Anzahl an Atompaaren

166 Zusammenfassung Die Sekundärstrukturelemente -Helix und -Faltblatt werden durch energetisch günstige Wasserstoffbrücken zwischen Atomen des Peptidrückgrats gebildet. Sie sind sequenzunabhängig. Protein ”folds” ergeben sich durch die Assemblierung von Sekundärstrukturelementen. Der Ramachandran-Plot ist ein wichtiges Werkzeug um die Güte von Protein-strukturen (bzw. –modellen) zu beurteilen. Proteine sind oft modular aus mehreren Domänen aufgebaut. Der Vergleich mehrerer Proteinstrukturen ist nicht-trivial.

167 V7: Aufklärung von Proteinstrukturen in der nahen Zukunft
Structural genomics soll die Strukturen von Proteinen vor allem mit neuen Faltungsmustern („folds“) aufklären. Bedeutung von Folds. Grundsätzliches zu Struktur – Funktion Beziehung. Definition von Folds: siehe V6 Homologiemodellierung der Strukturen aller verwandten Proteine unter Verwendung der bekannten 3D-Strukturen als Vorlagen.

168 Analyse einer unbekannten Sequenz
Input: neue Proteinsequenz Experimentelle Daten vorhanden? Multiples Sequenzalignment Suche in Sequenzdatenbanken nach identischer Sequenz bzw. ähnlichen Sequenzen Erkenne Domänen Gibt es ähnliche Sequenz mit bekannter 3D-Struktur? Nein Vorhersage der Sekundärstruktur Zuordnung eines Protein-Folds Analyse dieses Folds, Nachbarn? Ja Ja Fold erkannt? Alignment der Sekundärstrukturen. Nein Modellierung der Proteinstruktur durch Homologiemodellierung Alignment der Sequenz mit einer Target-Struktur Ab inito Vorhersage der Tertiärstruktur 3D-Proteinstruktur Nach Rob Russell, gtsp/flowchart2.html Kann man Funktion zuordnen?

169 Homologie/Komperative Modellierung
Qualität der Modellierung hängt von Sequenzidentität mit Vorlage ab. Protein structure modeling for structural genomics. R. Sánchez et al. Nat. Struct. Biol. 7, 986 - 990 (2000)

170 Genomweite Strukturmodellierung
Effekt des Wachstums der PDB-Datenbank auf die Zahl der Protein des Bakteriums M. Genitalium, deren Fold und Struktur im jeweiligen Jahr vorhergesagt werden konnte. Homologie-Modellierung ist nicht aufwendig, dauert pro Struktur nur wenige Minuten. Akkurate Modellierung von Loops und Seitenketten kann jedoch erheblich aufwendiger sein. Grün: Proteine mit Modell oder fold assignment aus PSI-BLAST für mindestens 30 ihrer Residuen. Blau: nur Modell Rot: Anteil der Residuen des Genoms, die in Modell oder fold assignment vorkommen. R. Sánchez et al. Nat. Struct. Biol. 7, 986 - 990 (2000)

171 Schliesse von Struktur auf Funktion?
From structure to function: Approaches and limitations J. M. Thornton et al. Nat. Struct. Biol. 7, 991  (2000)

172 Methode zur Fold-Erkennung: Threading
Gegeben: Sequenz: IVACIVSTEYDVMKAAR… Ein Datenbank von möglichen Proteinstrukturen (“folds”) Bilde die Sequenz auf jeden fold ab Bestimme anhand einer Bewertungsfunktion, welcher Fold am besten zu dieser Sequenz passt.

173 „New view of protein folding“:
Faltung entlang trichterähnlichen Energielandschaften Bryngelson, Wolynes, PNAS (1987) Gradient  Rauhigkeit beschleunigt bremst Faltung Faltung “Frustration” Brooks, Gruebele, Onuchic, Wolynes, PNAS 95, (1998)

174 Fold Optimierung Einfache Gittermodelle (HP-Modelle)
Zwei Sorten von Seitenketten: hydrophob und polar 2-D oder 3-D Gitter Treibende Kräfte: hydrophober Kollaps – es ist günstig, Kontakte zwischen hydropoben Seitenketten zu bilden Bewertung = Anzahl an HH Kontakten

175 Homologie-basierte Proteinmodellierung (SwissModel)
Methode: Wissensbasierter Ansatz. Erfordernis: Mindestens 1 bekannte 3D-Struktur eines verwandten Proteins, Prozedur: Superposition der verwandten 3D-Strukturen Erzeugung eines multiplen Sequenzalignments mit der Zielsequenz. Generierung eines Frameworks für die neue Sequenz. Konstruiere fehlende Loops. Vervollständige und korrigieren das Proteinrückgrat. Korrigiere die Seitenketten. Überprüfe die Qualität der modellierten Struktur und deren Packung. Strukturverfeinerung durch Energieminimierung und Moleküldynamik. SWISS-MODEL.html

176 Überlagerung der 3D-Strukturen
Regionen mit Sequenzähnlichkeit werden automatisch ausgewählt und ihre Residuen in 3D überlagert. Diese erste Auswahl wird weiter verfeinert. SWISS-MODEL.html

177 3D Framework für die neue Sequenz
Für alle Atome, die eine ähnliche Position besitzen und vermutlich eine strukturelle Entsprechung in der neuen Struktur besitzen, werden gemittelte Positionen als Framework-Koordinaten bestimmt. Seitenketten mit völlig inkorrekter Geometrie werden entfernt. Matrix mit Gewichten für lokale Ähnlichkeit. SWISS-MODEL.html

178 Konstruktion fehlender Loops
Basierend auf den Verankerungen der Loops werden wird eine Datenbank bekannter Loopfragmente in der PDB-Datenbank durchsucht. Für den neuen Loop verwendet man entweder das am besten passende Fragment oder ein Framework aus den 5 besten Fragmenten. Der Torsionsraum der Loopresiduen wird durchsucht - 7 erlaubte Kombinationen der - Winkel - benötigter Raum für den gesamten Loop SWISS-MODEL.html

179 Rekonstruktion von fehlendem Proteinrückgrat
Das Rückgrat wird auf der Grundlage von C -Positionen konstruiert. - 7 Kombinationen der - Winkel sind erlaubt. - Durchsuche Datenbank für Backbone-Fragmente mit Fenster aus 5 Residuen, Verwende die Koordinaten der 3 zentralen Residuen des am besten passenden Fragments.

180 Konstruktion unvollständiger/fehlender Seitenketten
Verwende Bibliothek erlaubter Seitenketten-Rotamere geordnet nach der Häufigkeit des Auftretens in der PDB-Datenbank. Erst werden verdrehte (aber komplette) Seitenketten korrigiert. fehlende Seitenketten werden aus der Rotamer-Bibliothek ergänzt. Teste dabei, ob van-der-Waals Überlapps auftreten und ob die Torsisonswinkel in erlaubten Bereichen liegen. SWISS-MODEL.html

181 Überprüfe die Qualität der 3D-Modelle
Analysiere 3D-Umgebung jeder Seitenkette. Erlaubt die Identifizierung missgefalteter Regionen. Auch: WHATCHECK SWISS-MODEL.html

182 Analyse der Packungsdichte eines atomaren Modells
Berechne, welche Bereiche des Proteins für eine kleine Probe zugänglich sind (Connolly-Oberfläche bzw. Kubisches Gitter). Algorithmus entdeckt Oberflächen innerhalb und ausserhalb des Proteins. Der Vergleich von Grösse und Verteilung von internen Cavities zwischen Modell und Kristallstruktur-Vorlage erlaubt es, Fehler im Modell aufzuspüren. SWISS-MODEL.html

183 Bewertung der Qualität eines Homologiemodells 1
Bewertung der Qualität eines Homologiemodells 1. Allgemeine Gesichtspunkte Ein Modell wird als falsch angesehen, wenn mindestens eines seiner strukturellen Elemente gegenüber dem Rest des Modells falsch angeordnet ist. Dies kann durch ein falsches Sequenzalignment entstehen. Das Modell kann dennoch korrekte Stereochemie besitzen. Man kann ein Modell als ungenau ansehen wenn seine atomare Koordinaten mehr als 0.5 Å von einer experimentellen Kontrollstruktur abweichen. Ungenauigkeiten können auch in der Stereochemie (Bindungslängen und –winkel auftreten). Dies kann leicht mit WhatCheck überprüft werden. Statistische Paarpotentiale für die Verteilung von Aminosäuren in bekannten Proteinen erlauben manchmal die Aufspürung von fehlerhaften Modellen.

184 2. Fehlerquellen Die Qualität eines Modells hängt von 2 Kriterien ab
Seine Korrektheit hängt von der Qualität des Sequenzalignments ab. Seine Genauigkeit wird durch seine Abweichung von einer (zukünftig zu bestimmenden) experimentellen Struktur bestimmt. Strukturelle Abweichungen haben 2 Ursachen - der inherente Fehler der Modellierungsprozedur - durch Umgebung und Methoden der Datenerfassung bewirkte Variationen der experimentellen Strukturen, die als Vorlage verwendet werden. Ein durch komparative Methoden abgeleitetes Protein-Modell kann nicht genauer sein als der Unterschied zwischen einer NMR-Struktur und einer Kristallstruktur desselben Proteins.

185 3 Proteinkern und Loops Fast jedes Proteinmodell enthält nicht-konservierte Loops, die als die am wenigsten zuverlässigen Teile des Proteinmodells angesehen werden können. Andererseits sind diese Bereiche der Struktur oft auch am flexibelsten – hohe Temperaturfaktoren in Kristallstrukturen oder hohe Unterschiede zwischen verschiedenen (gleichsam gültigen) NMR-Strukturen. Die Residuen im Proteinkern werden gewöhnlich fast in der identischen Orientierung wie in experimentellen Kontrollstrukturen modelliert. Residuen an der Proteinoberfläche zeigen grössere Abweichungen.

186 Einordnung von Proteinmodellen in 3 Kategorien
Modelle, die auf falschen Alignments zwischen Vorlage und Zielprotein basieren. Strategie: konstruiere mehrere Modelle für unterschiedliche Alignments. Wähle das am besten erscheinende Modell. Modelle, die auf korrekten Alignments beruhen, können für zielgerichtete Mutagenese-Experimente hilfreich sein. Sind oft nicht zuverlässig genug für detaillierte Untersuchung von Ligandenbindung. Modelle, die auf einer hohen Sequenzidentität (> 70%) mit der Vorlage beruhen. Solche Modelle können in Drug Design Projekten verwendet werden. Fehler sind jedoch immer, also auch bei sehr hoher Identität möglich.

187 Test für die Zuverlässigkeit von SwissModell
3DCrunch-Projekt von Expasy zusammen mit SGI. Generiere „Homologie-Modelle“ für Proteine mit bekannter 3D-Struktur. Die Vorlagen besaßen 25 – 95 % Sequenzidentität mit dem Zielprotein. 1200 Kontrolle-Modelle. Grad der Identität [%] Modell innerhalb von x Å RMSD zur Vorlage < 1 < 2 < 3 < 4 < 5 > 5 /SWISS-MODEL.html

188 Zusammenfassung Gemeinsamer Kern von Proteinen mit 50% Sequenzidentität besitzt ca. 1 Å RMSD Dies gilt sogar für absolute identische Sequenzen. Der zuverlässigste Teil eines Proteinmodells ist der Sequenzabschnitt, den es mit der Vorlage gemeinsam hat. Die größten Abweichungen liegen in den konstruierten Schleifen. Die Wahl der Modellvorlage ist entscheidend! Die An- oder Abwesenheit von Ko-faktoren, anderen Untereinheiten oder Substraten kann Proteinkonformation sehr beeinflussen und somit alle Modelle, die von ihnen abgeleitet werden. Jeder Fehler im Alignment produziert falsche Modelle! Solche Alignment-Fehler treten bei Sequenzidentität unter 40% auf.

189 V8 Protein-Liganden-Wechselwirkung – anschaulich betrachtet
Beispiele für Protein-Liganden Komplexe Wo ist das aktive Zentrum? (Docking wird hier nicht behandelt – siehe Spezialvorlesungen von A. Kämper und A. Hildebrandt/D. Neumann im SS05) Wie stark binden Liganden an Proteine? Wie kann man die Affinität des Liganden verbessern?

190 beta-Trypsin:Benzamidin (3ptb)
Enge, sehr polare Bindungstasche auf Proteinoberfläche. Amidin-Gruppen des Liganden bilden 4 H-Bindungen mit Carboxylgruppen des Proteins (Trypsin) aus. Benzolring passt optimal in hydro-phobe Tasche.

191 Cytochrome P450cam : Kampher (2cpp)
Weites, recht unpolares aktives Zentrum im Proteininneren. Hämgruppe katalysiert Reaktion. Partielle Desolvatation. Wie gelangt Substrat hinein?

192 Maus-Antikörper McPC-603:Phosphocholine (2mcp)
Bindungstasche auf Proteinoberfläche wird durch drei hypervariable Loops geformt.

193 Streptavidin:Biotin (1stp)
Sehr polare, tiefe Bindungstasche. Außerordentlich starke Affinität.

194 HIV-1 Protease:XK-263 Inhibitor (1hvr)
Inhibitor XK-263 stammt von Merck-Dupont. Er enthält eine 7-Ring zyklische Urea-Einheit mit Phenyl- und Naphtyl-Ringen. Die CO-Gruppe ahmt das ansonsten konservierte Wassermolekül 301 nach und verdrängt es. Der tiefere Teil des zyklischen Urea-Rings enthält zwei benachbarte Hydroxylgruppen, die H-Bindungen mit den katalytischen Aspartat-Residuen bilden.

195 Identifikation von funktionellen Residuen
1 Funktionelle bzw. katalytische Residuen werden traditionell in (hoch) konservierten Regionen von Multiple Sequence Alignments erwartet evtl. Kopplung mit Information über 3D-Struktur 2: finde Residuen, die Proteinstruktur destabilisieren. Grund: Funktionelle Residuen im Proteininneren sind oft energetisch ungünstig. Funktionalität auf Kosten von Stabilität. 3: finde Löcher oder Einbuchtungen in Proteinstruktur. Hier vorgestellt: integrierte Methode, die 1 -3 implementiert. Möglichkeit für funktionelle Annotation von Proteinen mit unbekannter Funktion.

196 Wo ist das aktive Zentrum I?
Auswahl von 49 Enzymen. Kriterien: - Auflösung  2.0 Å - funktionelle Residuen sind bekannt (in Swissprot-Eintrag in ACT_SITE) - enthalten nur eine Domäne (SCOP Datenbank) - die SCOP-Einträge sind unterschiedlich - es gibt  10 homologe Sequenzen mit Blast E-Wert < 98 katalytische Residuen: 22 His 17 Asp, Glu 10 Cys 8 Ser 7 Arg, Lys Ota, Kinoshita, Nishikawa, J Mol Biol 327, 1053 (2003) 5 Tyr 3 Asn 2 Thr

197 Repräsentative Enzyme
PDB Protein Länge Auflösung EC Zahl Zahl und Namen der SCOP Seq. katalytischen Residuen

198 Fitness-Funktion - Bewertung der Seitenketten-Konformation entsprechend Rotamer-Bibliothek - Seitenketten-Packung (wissensbasiert) - Hydratation (wissensbasiert) Analyse der Proteinoberfläche (MSP-Programm): Zuordnung zu den einzelnen Residuen - elektrostatische Energie: AMBER-Partialladungen  elektrostatisches Potential (aus Poisson-Boltzmann-Rechnung) Jeder Score(S), Rang (R) und Position (L) werden gegen den Mittelwert und die Standardabweichung für jeden Aminosäuretyp normalisiert. Ota, Kinoshita, Nishikawa, J Mol Biol 327, 1053 (2003)

199 Vorhersage katalytischer Residuen in Enzymen
Beispiel: 3D-Profil für Lysozym aus Hühnereiweiss. D52 ist katal. Residue. native Hydratations- lokale D52 hat sehr schlechten Rang. D.h. Residue klasse Struktur es wäre günstig D52 zu ersetzen. Katalytische Residuen sind stets un- stabiler als nicht-katalytische. Score Rang Score native native beste Residue Residue Residue Ota, Kinoshita, Nishikawa, J Mol Biol 327, 1053 (2003)

200 Vorhersage katalytischer Residuen in Enzymen
Flussdiagramm der Vorhersagemethode. - Links oben Analyse der Konservierung. - Rechts oben Analyse der Position in 3D-Struktur bzw. Stabilität der Mutantenproteine - untere Hälfte trifft für verschiedene Aminosäuretypen (1-Letter-code) die Entscheidung, ob katalytische Residuen vorliegen. Ota, Kinoshita, Nishikawa, J Mol Biol 327, 1053 (2003)

201 Wo ist das aktive Zentrum II
Analyse mit elektrostatischen Kontinuumsrechnungen Die Titrationszustände der meisten Aminosäuren folgen der Henderson-Hasselbalch-Gleichung. Berechne Titrationskurven für 3 Enzyme mit UHBD. TIM und AR haben eine sehr ähnliche Strukturen, katalysieren aber ganz unterschiedliche Reaktionen. AR und PMI haben sehr verschiedene Strukturen, katalysieren aber ähnliche Reaktionen. Ondrechen, Clifton, Ringe, PNAS 98, (2001)

202 Theoretische Titrationskurven
Titrationskurven aller His-Residuen in TIM Triosephosphat Isomerase (TIM) katalysiert die Isomerierung von D-Glyceraldehyd- 3-Phosphat zu Dihydroxyaceton-Phosphat. Man findet 4 Residuen mit verschobenen, flachen Titrationskurven: His95, Glu165, Lys112, Tyr164. Davon liegen H95, E165 und Y164 eng beieinander. Ondrechen, Clifton, Ringe, PNAS 98, (2001)

203 Theoretische Titrationskurven
Titrationskurven aller Tyr-Residuen in AR Ondrechen, Clifton, Ringe, PNAS 98, (2001) Aldose-Reduktase (AR) katalysiert die Reduktion einer Aldehydgruppe von Aldose zu einem Alkohol. Man findet 7 Residuen mit verschobenen, flachen Titrationskurven: Tyr48, Cys298, Glu185, Lys21, Lys77, Tyr107, Tyr209. Tyr48, His110 und Cys298 bilden das aktive Zentrum. Die anderen Residuen liegen in der Nähe.

204 Theoretische Titrationskurven
Titrationskurven aller Lys-Residuen in PMI Ondrechen, Clifton, Ringe, PNAS 98, (2001) PMI katalysiert die Interkonversion von Mannose-6-Phosphat und Fructose-6- Phosphat. Man findet 4 Residuen mit verschobenen, flachen Titrationskurven: His135, Lys100, Lys136, Tyr287. Alle liegen eng beieinander, die ersten 3 wohl im aktiven Zentrum und His135 nahe bei Lys136.

205 albumin Enzymfunktion
Weitere Beispiele PDB ID Name Chemie Residuen mit auffälligen Titrationskurven 1AMQ Aspartat [H189, Y225, K258, R266, C191, C192], aminotransferase* Transamination [Y256], [Y295], [H301] 1CSE Subtilisin Peptidhydrolyse [D32, H64] Carlsberg (Serin-Protease) 1EA5 Acetylcholinesterase Ester Hydrolyse [Y130, E199, E327, H440, D392], [Y148], [H398], [H425] 1HKA 6-Hydroxymethyl-* Kinase [D97, H115] 7,8-dihydropterin pyrophosphate kinase 1OPY 3-Keto-5-Steroid Isomerase [Y16, Y32, Y57], [C81] isomerase 1PIP Papain Peptidhydrolyse [C25, H159], (Cys Protease) [K17, K174, Y186], [R59], [R96] 1PSO Pepsin Peptidhydrolyse [D32, D215, D303], [D11] (Säure-Protease) 1WBA Winged bean Speicherung - keine keine albumin Enzymfunktion Residue im zweiter Schale. Ondrechen, Clifton, Ringe, PNAS 98, (2001) Residue im aktiven Zentrum

206 Fazit Mittels elektrostatischer Kontinuumsrechnungen für bekannte Kristallstrukturen von Proteinen wurde für verschiedene externe pH-Werte die energetisch optimale Gesamtladung der Proteine berechnet. Aktive Zentren von Enzymen enthalten oft mehrere polare bzw. geladene Seitenketten um die chemische Umwandlung zu katalysieren. Deren Titrationszustände sind eng aneinander gekoppelt und zeigen im Vergleich zu isolierten Seitenketten sehr ungewöhnliche Titrationskurven. Diese Methode erlaubt also die Position von aktiven Zentren allein aufgrund der Proteinstruktur zu erkennen. Ondrechen, Clifton, Ringe, PNAS 98, (2001)

207 Wie stark binden Liganden an Proteine?
Kuntz, Chen, Sharp, Kollman, PNAS 96, 9997 (1999)

208 Bindungsaffinität  Metallionen oder Metalloenzyme  kleine Anionen
 natürliche Liganden Enzyminhibitoren linearer Anstieg der freien Bindungsenthalpie zu Beginn bis ca. 15 Nicht-H-Atome Gbinding = - 60 kJ mol-1 maximal. Dann wird Sättigung beobachtet. Kuntz, Chen, Sharp, Kollman, PNAS 96, 9997 (1999)

209 Interpretation Metallionen und Anionen binden am stärksten.
Nanomolekulare Liganden können bereits mit 7-10 Atomen erreicht werden. Grössere Liganden - besitzen üblicherweise nur eine kleine Zahl polarer Atome pro Molekül - die elektrostatischen Gruppen der Bindungsstelle werden zunehmend im Inneren begraben - sind oft elektrisch neutral - besitzen mehr entropische Freiheitsgrade -G pro Atom Kuntz, Chen, Sharp, Kollman, PNAS 96, 9997 (1999)

210 Eine konkrete Studie an einem biologischen System – oft kommt es anders als man denkt.
Gu, W., Kofler, W., Antes, I., Freund, C., Helms, V. (2005) Biochemistry, 44, Alternative Binding Modes of Proline-rich Peptides Binding to the GYF-Domain. entfällt

211 Zusammenfassung Die Protein:Liganden Wechselwirkung ist heutzutage relativ gut verstanden. Wir haben Tools kennengelernt, mit denen man die Position des aktiven Zentrums lokalisieren kann Bindungsaffinitäten abschätzen bzw. verbessern kann die Assoziation bzw. Dissoziation des Liganden simulieren kann. Für die Zukunft bleibt: (1) korrelierte Analysen aus der umgekehrten Richtung: finde einen Liganden, der selektiv an ein bestimmtes Protein bindet, jedoch nicht an andere (2) Automatisierung + Verknüpfung der obigen Schritte (3) Einbeziehung zusätzlicher Gesichtspunkte (ADMET)

212 V9 From Protein Complexes to Networks and back
Protein interaction could be defined in a number of ways (1) Proteins that form permanent supracomplexes = „protein machines“ (2) Proteins that bind each other transiently (signal transduction, bioenergetics ... ) (3) Co-regulated expression of genes/proteins (4) Proteins participating in the same metabolic pathways (5) Proteins sharing substrates (6) Proteins that are co-localized Techniques: Experimental methods + computational methods.

213 How transferable are interactions?
interaction similariy (iRMSD) vs. % sequence identity for all the available pairs of interacting domains with known 3D structure. Curve shows 80% percentile (i.e. 80% of the data lies below the curve), and points below the line (iRMSD = 10 Å) are similar in interaction. Aloy et al. Science, 303, 2026 (2004)

214 6. In silico studies to predict protein protein contacts
Field of studying protein interactions is split into two areas: (1) on the macro level: map networks of protein interactions (2) on the micro level: understand mechanisms of interaction to predict interaction sites Growth of genome data stimulated a lot of research in area (1). Fewer studies have addressed area (2). Constructing detailed models of the protein-protein interfaces is important for comprehensive understanding of molecular processes, for drug design and for prediction the arrangement into macromolecular complexes. Also: understanding (2) should facilitate (1). Therefore, this lecture focusses on linking area (2) to area (1).

215 Bioinformatic identification of interface patches
Statistical analysis of protein-protein interfaces in crystal structures of protein-protein complexes: residues at interfaces have significantly different amino acid composition that the rest of the protein.  predict protein-protein interaction sites from local sequence information ? Conservation at protein-protein interfaces: interface regions are more conserved than other regions on the protein surface  identify conserved regions on protein surface e.g. from solvent accessibility Patterns in multiple sequence alignments: Interacting residues on two binding partners often show correlated mutations (among different organisms) if being mutated  identify correlated mutations Structural patterns: surface patterns of protein-protein interfaces: interface often formed by hydrophobic patch surrounded by ring of polar or charged residues.  identify suitable patches on surface if 3D structure is known

216 7 Analysis of interfaces
1812 non-redundant protein complexes from PDB (less than 25% identity). Results don‘t change significantly if NMR structures, theoretical models, or structures at lower resolution (altogether 50%) are excluded. Most interesting are the results for transiently formed complexes. permanent transient Ofran, Rost, J. Mol. Biol. 325, 377 (2003)

217 Amino acid composition of interface types
The frequencies of all residues found in SWISS-PROT were used as background  when the frequency of an amino acid is similar to its frequency in SWISS-PROT, the height of the bar is close to zero. Over-representation results in a positive bar, and under-representation results in a negative bar. Ofran, Rost, J. Mol. Biol. 325, 377 (2003)

218 Pairing frequencies at interfaces
red square: interaction occurs more frequently than expected; blue square: it occurs less frequently than expected. (A) Intra-domain: hydrophobic core is clear (B) domain–domain, (C) obligatory homo-oligomers, (D) transient homo-oligomers, (E) obligatory hetero-oligomers, and (F) transient hetero-oligomers. The amino acid residues are ordered according to hydrophobicity, with isoleucine as the most hydrophobic and arginine as the least hydrophobic.  propensities have been successfully used to score protein-protein docking runs. Ofran, Rost, J. Mol. Biol. 325, 377 (2003)

219 8 Correlated mutations at interface
Pazos, Helmer-Citterich, Ausiello, Valencia J Mol Biol 271, 511 (1997): correlation information is sufficient for selecting the correct structural arrangement of known heterodimers and protein domains because the correlated pairs between the monomers tend to accumulate at the contact interface. Use same idea to identify interacting protein pairs.

220 Correlated mutations at interface
Correlated mutations evaluate the similarity in variation patterns between positions in a multiple sequence alignment. Similarity of those variation patterns is thought to be related to compensatory mutations. Calculate for each positions i and j in the sequence a rank correlation coefficient (rij): where the summations run over every possible pair of proteins k and l in the multiple sequence alignment. Sikl is the ranked similarity between residue i in protein k and residue i in protein l. Sjkl is the same for residue j. Si and Sj are the means of Sikl and Sjkl. Pazos, Valencia, Proteins 47, 219 (2002)

221 i2h method Schematic representation of the i2h method.
A: Family alignments are collected for two different proteins, 1 and 2, including corresponding sequences from different species (a, b, c, ). B: A virtual alignment is constructed, concatenating the sequences of the probable orthologous sequences of the two proteins. Correlated mutations are calculated. C: The distributions of the correlation values are recorded. We used 10 correlation levels. The corresponding distributions are represented for the pairs of residues internal to the two proteins (P11 and P22) and for the pairs composed of one residue from each of the two proteins (P12). Pazos, Valencia, Proteins 47, 219 (2002)

222 Predictions from correlated mutations
Results obtained by i2h in a set of 14 two domain proteins of known structure = proteins with two interacting domains. Treat the 2 domains as different proteins. A: Interaction index for the 133 pairs with 11 or more sequences in common. The true positive hits are highlighted with filled squares. B: Representation of i2h results, reminiscent of those obtained in the experimental yeast two-hybrid system. The diameter of the black circles is proportional to the interaction index; true pairs are highlighted with gray squares. Empty spaces correspond to those cases in which the i2h system could not be applied, because they contained <11 sequences from different species in common for the two domains. In most cases, i2h scored the correct pair of protein domains above all other possible interactions. Pazos, Valencia, Proteins 47, 219 (2002)

223 Predicted interactions for E. coli
Number of predicted interactions for E. coli. The bars represent the number of predicted interactions obtained from the 67,238 calculated pairs (having at least 11 homologous sequences of common species for the two proteins in each pair), depending on the interaction index cutoff established as a limit to consider interaction. Among the high scoring pairs are many cases of known interacting proteins. Pazos, Valencia, Proteins 47, 219 (2002)

224 9 Coevolutionary Analysis
Idea: if co-evolution is relevant, a ligand-receptor pair should occupy related positions in phylogenetic trees. Goh & Cohen, 2002 showed that within correlated phylogenetic trees, the protein pairs that bind have a higher correlation between their phylogenetic distance matrices than other homologs drawn drom the ligand and receptor families that do not bind. Other Idea: analyze occurrence of proteins that can functionally substitute for another in various organisms. Detect analogous enzymes in thiamin biosynthesis

225 Detect analogous enzymes in thiamin biosynthesis
Gene names are applied according to the first gene described from a group of orthologs. Solid black arrows represent known or proposed reaction steps and dashed black arrows indicate unknown reactions. In addition, significant anticorrelations in the occurrence of genes across species (red arrows), and relevant in silico predicted protein-protein interactions (blue dashed arrows) are illustrated. Distinct precursors have been proposed for different species (indicated in gray). Genes with orthologous sequences in eukaryotes and prokaryotes are in green; genes assumed to be prokaryote-specific are black. Interestingly, significant 'one-to-one' anticorrelations usually involve a prokaryote-specific and a 'ubiquitous' gene. Abbreviations: AIR, 5-aminoimidazole ribonucleotide; Cys, cysteine; Gly, glycine; His, histidine; HMP, 2-methyl-4-amino-5-hydroxymethylpyrimidine; THZ, 4-methyl-5- -hydroxyethylthiazole; Tyr, tyrosine; Vit. B6, Vitamin B6. Morett et al. Nature Biotech 21, 790 (2003)

226 THI-PP biosynthesis pathway: analogous genes
Negatively correlating gene occurrences are highlighted using the same colors. Species having at least two genes with a role unique to THI-PP biosynthesis are predicted to possess the functional pathway. The column 'STRING score' shows the most significant interaction for each gene, predicted using the STRING server. Predicted interaction partners are listed in the column 'Interact. with'. COG id: „id in groups of orthologous proteins server“ (a) Essential THI-PP biosynthesis enzymes, which are unique to the pathway. (b) Essential THI-PP biosynthesis enzymes, which have been implicated in more than one biological process. The thiO gene, suggested to play a role in the pathway, was also added to that list. (c) Proteins predicted in silico to be involved in the pathway. 4 analogies detected: thiE can be replaced by MTH861 thiL by THI80 thiG by THI4 thiC by tenA Morett et al. Nature Biotech 21, 790 (2003)

227 Interpretation Proteins that functionally substitute eachother
have anti-correlated distribution pattern across organisms.  allows discovery of non-obvious components of pathways and function prediction of uncharacterized proteins and prediction of novel interactions. Morett et al. Nature Biotech 21, 790 (2003)

228 Bereich 3: V10 - Integrative Biologie
1 Protein-Netzwerke: topologische Graphen-Netzwerke 2 Analyse von Stoffwechselwegen (metabolic pathways): Konzentration auf Metabolite, enzym. Reaktionen 3 Zell-Simulationen: dynamische Simulation auf Sekunden-Zeitskala, t = 0.01 s (V10 und V11) Systems Biology: Integration von genomischen und proteomischen Analysen (V12) Komplexität, Level an Verständnis

229 Analyse von Stoffwechselwegen: Beispiel E. coli
verwende Daten aus Datenbank EcoCyc (siehe auch MetaCyc: Stoffwechsel von > 150 Organismen) EcoCyc enthält 905 Reaktionen für E.coli davon gehören 161 nicht zum Stoffwechsel kleiner Moleküle, z.B. DNA Replikation, von den verbleibenden 744 wurden 569 mindestens einem Pfad zugeordnet Dagegen gibt es 607 Enzyme. Es gibt also keine 1:1 Zuordnung zwischen Enzymen und Reaktionen, denn (1) Manche Enzyme katalyiseren mehrere Reaktionen, und manche Reaktionen werden von mehreren Enzymen katalysiert (2) nicht zu allen Reaktionen sind die Enzyme bekannt, die sie katalysieren. Ouzonis, Karp, Genome Research 10, 568 (2000)

230 Beispiel: Stoffwechsel von E. coli
Die 744 Reaktionen enthalten 791 verschiedene Substrate. Im Mittel enthält jede Reaktion 4 Substrate. Ouzonis, Karp, Genome Research 10, 568 (2000)

231 Beispiel: Stoffwechsel von E. coli
EcoCyc enthält 131 Stoffwechsel- Pfade. Die Länge der Pfade variiert von 1 bis 16. Im Mittel 5.4. Von den 607 Enzymen sind 100 multifunktional. Purin-Nukleosid-Phosphorylase und Nukleosid-Diphosphatkinase katalysieren 7 bzw. 9 Reaktionen. 483 Reaktionen gehören zu einem Pfad, 99 Reaktionen gehören zu mehreren Pfaden. Ouzonis, Karp, Genome Research 10, 568 (2000)

232 Fazit Stoffwechsel-Netzwerke von einfachen Organismen sind mittlerweile fast vollständig bekannt. Ist die Beschreibung mit einzelnen Stoffwechsel-Wegen adäquat? - Reaktionen, Enzyme und Substrate gehören oft zu mehreren Pfaden. - Die Einteilung in einzelne Stoffwechsel-Pfade ist nicht immer eindeutig.

233 Metabolische Pfade in der post-genomischen Ära
(a) klassische Biochemie bestimmt Stöchiometrien einzelner Reaktionen (b) Katalogisierung vieler Reaktionen, Gruppierung nach gemeinsamen Metaboliten führt zu traditionellen Pfaden wie Glykolyse, Pentose-Phosphat- Pfad (c) Durch komplette Information können nun die kompletten metabolischen Pfade zugeordnet werden.

234 Metabolische Pfade in der post-genomischen Ära
Traditionelle metabolische Pfade dienen als konzeptioneller Rahmen für Forschung und Lehre. Man kann dadurch Metabolismen verschiedener Organismen vergleichen. Jedoch sind sie nicht für quantitative, systemische Bewertungen biologischer Reaktionsnetzwerke geeignet, da sie nur Teile der Netzwerke darstellen. Sie wurden oft in Zelltypen entdeckt, in denen sie wichtige metabolische Funktionen übernehmen (z.G. Glykolyse in Hefe). Man kann diese Pfade jedoch nicht einfach auf andere Zelltypen mit anderen Enzymleveln und metabolischen Profilen übertragen.

235 3 Vorgehensweisen 1 konstruiere alle Transformationswege, die von einem gegebenen Substrat zu einem gegebenen Produkt führen 2 verwende Satz von linear (systemisch) unabhängigen Basisvektoren im Raum der Reaktionsflüsse, durch Linearkombination sollen sich alle möglichen Flußverteilungen darstellen lassen. Allerdings ist die Wahl dieser Basisvektoren nicht eindeutig. 3 Konzept der elementaren (Fluss-) Moden Eine Elementarmode ist ein minimaler Satz von Enzymen, die im Gleichgewicht operieren können. Minimal heisst: falls nur die Enzyme dieser Mode operieren, führt Inhibition jedes einzelnen seiner Enzyms zum Stop aller Gleichgewichtsflüsse im System

236 Beschreibung vernetzter metabolischer Pfade
Papin et al. TIBS 28, 250 (2003) (a) aus genomischen, biochemischen, physiologischen Daten wird ein Reaktionsnetzwerk aufgestellt. Es gibt interne Flüsse innerhalb der Systemgrenzen und externe Flüsse mit der Umgebung. (b) Dieses Netzwerk wird durch eine stöchiometrische Matrix dargestellt, in der Metaboliten durch Reaktionen miteinander verbunden werden. (c) Mögliche Zustände der Zelle aufgrund dieser Matrix werden mit Techniken wie „elementary modes“ oder „extreme pathways“ identifiziert. Die möglichen Zustände liegen innerhalb eines Konus im durch die verschiedenen Flüsse aufgespannten Koordinatensystem.

237 Analyse der stöchiometrischen Matrix
Koeffizienten der einzelnen Reaktionen. Darstellung des Reaktions- netzwerks mit stöchiometrischer Matrix S. Metabolite Analyse der Matrix S  Pathway-Darstellung P. Deren Zeilen enthalten den Reaktionen entsprechende Flüsse und die Spalten die sich ergebenden Pfade. Darstellung der Pfade ist möglich für einfache Netzwerke. Papin et al. TIBS 28, 250 (2003)

238 Netzwerk-Analyse (a) welche Substrate (A-E) sind zur
Produktion der Biomasse erforderlich (B,E), welche nicht? (b) Aufspüren von nicht genutzten Reaktionen (F  E), Refinement der Annotation von Genomen. Papin et al. TIBS 28, 250 (2003) (c) quantitative Beschreibung von Pathway-Redundanz bzw. Robustheit des Netzwerks: P1 und P2 führen beide von A nach D. (d) Reaktionen RA, RB und RC werden stets gemeinsam benutzt. Ihre Gene werden daher vermutlich koordiniert reguliert.

239 E-cell: Software Umgebung zur Simulation ganzer Zellen
Institute for Advanced Biosciences der Keio University (existiert seit 1996) Dr. Masaru Tomita, Team enthält > 50 Mitglieder! weitere Programme für integrative Zellsimulationen: GEPASI (1993, 1997) – Simulation von Stoffwechselpfaden KINSIM (1983, 1997) METAMODEL (1991) SCAMP (1993) DBSolve (1997) V-Cell (1999) es gibt auch separate Programme, mit denen man Genregulation und –expression, sowie Signaltransduktion und Zellteilung untersuchen kann. Das allgemeine Problem sind fehlende experimentelle Daten.

240 Implementation des E-cell Systems
E-CELL wurde in C++ geschrieben, existiert nun in der Version 3. Das Modell besteht aus 3 Listen, die bei Programmstart geladen werden: substance list definiert alle Objekte, die die Zelle und das Kulturmedium enthalten rule list definiert alle Reaktionen, die in der Zelle stattfinden system list definiert die räumliche und/oder funktionelle Struktur der Zelle und ihrer Umgebung Der Zustand der Zelle zu jedem Zeitpunkt wird als Liste von Konzentrationen und globalen Parametern wie Zellvolumen, pH und Temperatur angegeben. Das Programm (simulation engine) erzeugt neue Zustände der Zelle nach Iterationsschritten von jeweils z.B. t = 1 ms.

241 Erstes Modellsystem: Mycoplasma genitalium
1996 Veröffentlichung des Genoms von Mycoplasma genitalium Dies ist eines der kleinsten bisher bekannten Genome (580 kb). Es enthält die kleinste bisher bekannte Anzahl von Genen (ca. 480) von allen bisher bekannten lebenden Organismen. Genom ist 10  kleiner als E.coli ca. 80% der Gene sind homolog zu Proteinen mit bekannter Funktion. Intensive Gene-Knockout Untersuchungen zeigten, dass viele der 480 Gene für das Überleben von M. genitalium nicht notwendig sind. Es wurde ein minimaler Satz von 127 Genen als notwendig und hinreichend für das Überleben und einen stabilen Zustand der Zelle ausgewählt.

242 Large-scale Organisation von metabolischen Netzwerken
Modell einer Zelle, die aus eigener Kraft lebt. Diese minimale Zelle besitzt 127 Gene, gerade ausreichend um Proteingehalt und Membranstruktur aufrecht zu erhalten. Glukose wird aus der Umgebung als Energiequelle aufgenommen; ATP wird durch den Glykolyse-Pfad produziert und wird hauptsächlich zur Proteinsynthese verbraucht. Proteine und Phospholipide werden mit der Zeit spontan abgebaut.

243 Ausblick Zusätzlich zu der „virtuellen, überlebensfähigen Zelle“ und zum Modell des menschlichen Erythrozyten werden in Keio andere Modelle konstruiert: - ein Modell eines Mitochondriums - ein Signaltransduktionsmodell für Chemotaxis in E.coli Ein allgemeines Problem von umfangreichen Zellmodellen ist derzeit der Mangel an quantitativen experimentellen Daten: Konzentrationen von Metaboliten und Enzymen Flussraten kinetische Parameter und Dissoziationskonstanten Das Institute of Advanced Biosciences in Keio besteht aus 3 Zentren: Metabolom-Forschung, Bioinformatik, Genom-Engineering. Ziel: Entwicklung von custom-made Bakterien.

244 V11 Zellsimulationen Nerven-Verbindung (synaptischer Spalt). Nach seiner Auschüttung bindet der Neurotransmitter Acetylcholin (hellblaue Kugeln) an die Acetylcholinrezeptoren (tassenförmige Objekte) und an Acetylcholinesterase. Doppelt besetzte Rezeptoren (gelb) leiten Strom, der eine Kaskade von Vorgängen einleitet, die zur Kontraktion des Muskelstrangs führen. Diese und nächste Stunde werden 3 Simulationspakete behandelt, E-cell, Virtual Cell, Mcell, die 3 verschiedene Paradigmen für Zellsimulationen verkörpern - ODE = gewöhnliche Differentialgleichungen, enthalten ∂/∂t grösseres - PDE = partielle Differentialgleichungen, enthalten ∂/∂t und ∂/∂r Detail - explizite Simulation der Brownschen Bewegungen einzelner Moleküle - Projekte unserer Arbeitsgruppe

245 Virtual Cell: Software-Umgebung für computerunterstützte Zellbiologie
Prof. Leslie Loew, University of Conneticut Health Center National Resource for Cell Analysis and Modeling Virtual Cell - wurde für die Zellbiologie-Community entwickelt ermöglicht die Konstruktion räumlicher Modelle Verbindung zur quantiativen Lichtmikroskopie an lebenden Zellen Kann man auf der Basis des komplexen räumlichen und zeitlichen Zusammen-spiels der Zellkomponenten ein quantitatives Verständnis des gesamten zellulären Verhaltens entwickeln? Sind die identifizierten Komponenten notwendig und hinreichend? Wie sensitiv reagiert der Gesamtprozess auf Veränderungen einer Komponente? (Zellen sind „robust“). - Die Simulationen werden über das Internet auf einem 16-Prozessor cluster mit Alpha-Prozessoren durchgeführt.

246 Design einer Virtuellen Zelle
Die `Physiologie' beinhaltet die topologische Anordnung von Kompartments und Membranen, die mit ihnen assoziierten Moleküle, und die Reaktionen zwischen den Molekülen. Die getrennt definierte `Geometrie‘ ist eine räumliche Beschreibung der Kompartments in 0-3 Dimensionen. Sie kann aus analytischen Ausdrücken bestehen oder aus einem experimentellen Bild abgeleitet werden, das z.B. von einem Mikroskop stammt. Das eigentliche Modell besteht aus der Verbindung der Topologie der physiologischen Beschreibung mit einer geeigneten räumlichen Geometrie.

247 Virtual cell: graphische Benutzerschnittstelle (GUI)
Das GUI von Virtual Cell ist als JAVA applet innerhalb eines Webbrowsers entwickelt. Hier sieht man, wie eine Zelltopologie einer bestimmten experimentellen Geometrie zugeordnet wird.

248 Einzelschritte bei Erstellung von BioModellen
Structure Mapping – definiert die Beziehung zwischen der Physiologie (zelluläre Strukturen) und der Geometrie des Modells. Bestimme das Verhältnis von Oberfläche zu Volumen für die Modelle der Kompartments oder für nicht aufgelöste räumliche Strukturen. Bilde die zellulären Strukturen auf geometrische Objekte ab. Wähle zwischen unterschiedlichen Randbedingungen (Wert bzw. Ableitung am Rand = Dirichlet bzw. Neumann) für die Strukturen. Anfangsbedingungen – Konzentrationen und Diffusionsraten können räumlich variable definiert werden. Wähle Anfangsbedingungen für Diffusion ≠ 0. Reaction Mapping – erlaube oder verbiete Reaktionen bzw. Flüsse. Math Viewer – prüfe die mathematische Beschreibung, die vom Programm automatisch für die Abbildung des physiologischen Modells auf ein Kompartment-Modell oder auf ein räumliches Modell erstellt wird.

249 Virtual cell: Ausblick
aktuelle Version: - ermöglicht Simulation von Reaktions-Diffusionsprozessen in beliebigen Geometrien. Anpassung notwendig für Probleme, die Änderungen der Geometrie erfordern (Zellwanderung, Zellteilung). behandelt nur bestimmte Sorten von stochastischen Prozessen: Brownsche Bewegung, gerichtete Teilchenbewegung entlang von Mikrotubuli, Reaktion einzelner Teilchen mit kontinuierlich verteilten Molekülen. - wenn die Anzahl an wechselwirkenden Molekülen zu klein wird, braucht man statt der stochastischen Beschreibung Reaktionen zwischen diskreten Molekülen. - Behandlung diskreter Zustände ist auch erforderlich zur Modellierung der Ströme von einzelnen Ionenkanälen und deren räumlicher Verteilung.

250 M-cell: Allgemeine Monte–Carlo Simulation von zellulären Mikrophysiologien
Thomas M. Bartol Jr Joel R. Stiles Computational Neurobiology Laboratory Biomedical Applications (T. Sejnowski), Salk Institute, San Diego Pittsburgh Supercomputing Center Ziel: quantitatives, molekulares Verständnis der Nervenfortleitung, Funktion von Nervengasen, Modulatoren, oder Autoimmunerkrankungen.

251 MCell: Idee + Motivation
MCell ermöglicht 3-D Monte–Carlo Simulationen für Ligandendiffusion und chemische Signalprozesse. Biologische Strukturen wie Neuronen zeigen auf der subzellulären Ebene eine enorme Komplexität und Diversität. Die inter- und intrazelluläre Kommunikation geschieht mittels verschiedener chemischer Signalpfade. Am Prozess der synaptischen Transmission sind z.B. Neurotransmitter und Neuromodulatoren beteiligt. Ebenfalls beteiligt sind Proteine, die die Auffüllung und Entleerung der synaptischen Vesikel mit Neurotransmitter-Molekülen beeinflussen, Rezeptorproteine, Transportproteine, sowie oxidierende und hydrolytische Enzyme. Mit Mcell kann man alle diese Parameter in beliebig komplexen räumlichen Darstellungen der beteiligten zellulären Strukturen darstellen und variieren. Anfangsbedingung: Eine Monte–Carlo Simulation beginnt damit, dass die Zellumgebung mit einzelnen Liganden und Liganden-bindenden Molekülen angefüllt wird.

252 Warum soll man Monte Carlo Algorithmen benutzen. 1
Warum soll man Monte Carlo Algorithmen benutzen? 1. löse PDEs zwischen Voxels Die Diffusion von Ligandenmolekülen in Lösung basiert auf Brownscher Bewegung. Der mittlere Netto-Fluss aus einer Region des Raums in eine andere hängt von der Mobilität der Moleküle und dem räumlichen Konzentrationsunterschied der beiden Regionen ab. Eine Methode, den räumlichen Gradienten zu berechnen, ist, den Raum in kleine, üblicherweise kubische Volumenelemente (Voxels) aufzuteilen, innerhalb derer man gute Mischung annimmt, und dann mittels eindimensionaler partieller Differentialgleichungen den mittleren Fluss durch die Verbindungsfläche zwischen angrenzenden Voxeln zu berechnen. Sofern die Granularität der räumlichen und zeitlichen Unterteilung fein genug ist, wird eine numerische Simulation das korrekte mittlere Verhalten des Systems erzeugen.

253 löse PDEs innerhalb von Voxels
Man kann weitere PDEs hinzufügen um die mittlere Raten chemischer Raten Reaktionen innerhalb jedes Voxels zu beschreiben. Man erhält damit eine Simulation des räumlichen und zeitlichen Diffusionsverhaltens und der chemischen Reaktionen. Für einfache räumliche Anordnungen kann diese Methode sehr effizient sein. Für komplexe (d.h. realistische) Structuren werden die räumlichen Unterteilungen immer komplexer und eine grosse Anzahl an Voxeln ist erforderlich. Auf jeden Fall liefert die Simulation keine direkten Informationen über die stochastischen Schwankungen, die auf der endlichen Anzahl an beteiligten Molekülen beruhen. Diese sind in biologischen Systemen jedoch oft von grossem Interesse.

254 2. völlig andere Methode: Random walk
Direkte Beschreibung der Brownschen Bewegung der einzelnen Ligandenmoleküle. Durch Verwendung von Zufallszahlen werden bei jedem Zeitschritt beliebige erlaubte Richtungen und Verschiebungen ausgewählt. Indem die Zeitschritte und Verschiebungen deutlich kleiner als die Teilchengröße gehalten werden, erreicht man eine hohe numerische Genauigkeit. Kollisionen mit beliebigen Oberflächen werden entdeckt und gemäss von Regeln behandelt (Bindung, Transport, Reflexion etc.). Voxel sind unnötig. Gleichsam werden Kollisionen mit möglichen Bindungsstellen entdeckt und behandelt. Für die Ausbildung von Bindungen werden Bindungswahrscheinlich-keiten festgelegt. Die momentane Entscheidung wird durch eine Zufallszahl bestimmt. Alle möglichen Vorgänge werden auf einer Molekül-für-Molekül Basis betrachtet. Dadurch enthält die Simulation realistische stochastische Schwankungen in Abhängigkeit von der räumlichen Verteilung und der Anzahl an Molekülen.

255 Typische Vorgänge während einer MCell-Simulation
Freisetzung von Ligandenmolekülen aus einer Struktur (z.B. einem Vesikel) Erzeugung oder Vernichtung von Ligandenmolekülen (z.B. Synthese, Hydrolyse, oder Redox-Reaktionen) Diffusion der Liganden innerhalb des Raums zwischen beliebigen Oberflächen (z.B. prä- und postsynaptische Membranen) chemische Reaktionen von Ligandenmolekülen mit “Effektor”molekülen (z.B. Rezeptoren oder Enzyme)

256 MCell: biologische Skala
Der Level an Detail von MCell Simulationen liegt zwischen denen von atomistischen Moleküldynamik-Simulationen und der Simulationen gesamter Zellen (Virtual Cell, E-cell). Die Diffusion einzelner Ligandenmoleküle wird als Brownsche Bewegung mit einem Random–Walk–Algorithmus simuliert. Mittlere Ratenkonstanten werden in Monte– Carlo–Wahrscheinlichkeiten für Reaktionen einzelner Moleküle pro Zeitschritt umgeformt. Damit können die Ligandenmoleküle stochastisch reagieren sobald sie an Rezeptoren, Enzyme oder Transporter gebunden sind.

257 Zusammenfassung Zellsimulationen sind im Kommen!
Detaillierte, dreidimensionale Modelle sind notwendig, sobald Lokalisation z.B. an Membran stattfindet, und sobald wichtige Moleküle in kleinen Zahlen vorliegen. Schlagwort: Systems Biology. Messung von kinetischen Konstanten im Allgemeinen mühsam. Daher zunächst Konzentration auf Modellsysteme. Molekulare Simulationen können sehr aufwendig sein. Ein Volumen von 100 nm3 enthält ca Proteine. 1 μm3 enthält dagegen bereits ca. 106 Proteine. Bei Beschränkung auf Molekül-Konzentrationen kann dagegen fast in real time simuliert werden.

258 V12 Bioinformatik-Tools für HT Proteinanalyse
traditionelle Ansätze: reduktionistisch; finde einzelne Gene und die kodierten Proteinprodukte, die einen beobachteten Phänotyp definieren. Oft werden hierdurch komplexe Systeme zu stark vereinfacht. Hoch-Durchsatzmethoden: parallele Untersuchung vieler gleichzeitiger Vorgänge omics-Welt: Genomics, Proteomics, Metabolomics, Transcriptomics ...

259 Wie soll man das Proteom untersuchen?
Proteomics zerfällt derzeit in 2 Bereiche Expression Proteomics katalogisiere alle Proteine in einer Probe differentielle Expression: Unterschied zwischen mehreren Proben Cell-map Proteomics Protein-Protein Wechselwirkung Protein-Liganden Wechselwirkung zelluläre Lokalisation

260 Expressions-Proteomik
Das zelluläre Proteom enthält ende von Proteinen, deren Konzentrationen mehr als 106 fach verschieden sind. Prof. Walter (UdS)

261 Technologien in Proteomics
Separation von Proteinen 2-D gel Elektrophorese Flüssig-Chromatographie Affinitäts-Chromatographie Annotation einzelner Proteine Massenspektroskopie kombinierte HPLC und MS Protein-Quantifizierung mit MS Protein-Chips

262 Analytische versus funktionelle Protein-Microarrays
(a) analytische Microarrays: beobachte Proteinexpression und klinische Diagnostik. Vergleiche Proteinproben zweier biologischer Zustände, wobei die Protein entweder mit einem grünen oder mit einem roten Farbstoff gelabelt werden. Wenn eine Farbe überwiegt, liegt das Protein vornehmlich in dem entsprechenden Zustand vor. (b) funktionelle Microarrays: visualisieren Proteinaktivität, -bindung oder posttranslationelle Modifikationen. Auch geeignet um Substrat- oder Inhibitor-bindung an Enzyme zu messen und zur Konstruktion biologischer Netzwerke. Phizicky et al. Nature 422, 208 (2003)

263 Yeast Two-Hybrid Methoden
(a) die DNA-bindende und die Aktivierungsdomänen (Kreise) sind an die Protein X und Y fusioniert. Genexpression des Reporters beginnt. (b) Standard-2YH-Suche von X gegen eine komplexe Bibliothek von zufälligen, mit Y fusionierten Peptid-Schnipseln. (c) 2YH-Array. Screene X gegen komplette Satz von ORFs. Phizicky et al. Nature 422, 208 (2003)

264 Zweidimensionale Gelelektrophorese (2D PAGE)
2D Polyacrylamid-Gel für ein Biopsie-Probe mit menschlicher Leber. In x-Richtung – nichtlinearer pH-Gradient - geschieht eine Auftrennung nach dem isoelektrischen Punkt (bei welchem pH ist die Ladung des Proteins neutral?). In y-Richtung geschieht durch Variation des Anteils an Polyacrylamid eine Trennung nach der molekularen Masse. Problem: man kann nur Proteine visualisieren, die relativ häufig vorkommen. Banks et al. Lancet 356, 1749 (2000)

265 Annotation von 2D-Gelen: mühsam
Banks et al. Lancet 356, 1749 (2000)

266 Fallstudie: Expressions-Proteomik
Proteine des Rinderherzen: welche Proteine sind im Herzen von Rindern mit einer vererbten Kardiomyopathie reduziert? Die Balken 1-6 stammen von Kardiomyopathie-diagnostizierten Rindern, 7-12 von gesunden Rindern sind Rinder, die selbst klinisch normal sind, aber von kranken Rindern abstammen (nur SPP 943 ist deutlich abgesenkt). Banks et al. Lancet 356, 1749 (2000)

267 (Bio)informatische Aufgaben bei Analyse von 2D-Gelen
Zwei Gele stimmen oft in Grösse, Kontrast, Auftrennung in x- und y-Richtung nicht überein. Darüberhinaus treten Unterschied als Folge der experimentellen Bedingungen auf. Der Vergleich zweier Gele erfordert daher oft Methoden der Bildbearbeitung, z.B. mit dem Programm Flicker Eine Laplace-Transformation verbessert die Übereinstimmung zwischen dem linken und rechten Gel erheblich in (b) gegenüber (a). Lemkin PF, Electrophoresis, 18, (1997)

268 Fraktionierung der Probe vor 2D PAGE-Analyse
Oft gibt es das Problem, dass die Proteineigen-schaften über einen sehr grossen Bereich variieren. Lösung: konzentriere auf Teil der Proteine. z.B. (a) versehe die ansonsten schwer detek-tierbaren Proteine an der Membranoberfläche mit einem Biotin ‚Anker‘ (tag). Auftrennung in 2D-Gel. Erkenne die markierten Proteine mit Avidin. Identifikation mit MS. (b) Getrennte Visualisierung der markierten Proteine (oben) gegenüber der Darstellung des gesamten Zell-Lysats (unten). Dies erlaubte die Identifikation neuer Proteine auf der Oberfläche von Krebszellen. Hanash, Nature 422, 226 (2003)

269 Direkte Visualisierung der Protein-Verteilung mit MS
Ein gefrorener Schnitt durch ein Rattengehirn wird mit einem MALDI MS-Gerät abgetastet. Hier: je 15 Spektren für 74  75 Punkte, gleichzeitige Aufnahme aller Massen. Visualisiere den Schnitt getrennt für verschiedene Verhältnisse von Masse und Ladung (jeweils oben rechts gezeigt). z.B. ist die Proteindichte für m/z=6844 recht gering. Ziel: vergleiche gesundes und krankes Gewebe. Hanash, Nature 422, 226 (2003) Aufgabe: Bildverarbeitung

270 Proteomics mit Massenspektroskopie (MS)
(1) Aufreinigung (SDS-PAGE). Banden ausschneiden. (2) Problem: Gesamtmasse eines Proteins ist nicht aussagekräftig. Daher Trypsin (Protease)-Verdau  Peptidschnipsel unterschiedlicher Länge, diese sind charakteristisch für Protein. (3) MS-Analyse in Vakuum (4) Detektion der Massenintensität bei vorgegebenem Verhältnis von Masse m und Ladung z. (5) Weitere Auftrennung der einzelnen Peptidschnipsel in zweitem MS-Schritt. Teilweise Sequenzierung möglich. Aufgabe: Annotation des Proteins aus Sequenz-Datenbank. Tyers, Mann, Nature 422, 193 (2003)

271 Sequenzdiversität in der Zelle: Analyse mit MS
Organismus kodiert über das Genom viele Isoformen. Identifikation der Proteine durch Datenbanksuche um die Lücken der exp. Daten zu füllen. Sequenz-Datenbanken enthalten jedoch keine komplette Information über die natürlich auftretende Sequenzdiversität. Rappsilber, Mann, TIBS, 27, 74 (2002)


Herunterladen ppt "V13 Zusammenfassung (V1 – V12)"

Ähnliche Präsentationen


Google-Anzeigen