Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

BIOML & Friends George Gentsch, Lukas Stingelin. 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends2 BIOML & Friends Übersicht Allgemeine Einführung.

Ähnliche Präsentationen


Präsentation zum Thema: "BIOML & Friends George Gentsch, Lukas Stingelin. 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends2 BIOML & Friends Übersicht Allgemeine Einführung."—  Präsentation transkript:

1 BIOML & Friends George Gentsch, Lukas Stingelin

2 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends2 BIOML & Friends Übersicht Allgemeine Einführung in BIOML Biologischer Kontext Implementation biologischer Sachverhalte Struktur und Elemente von BIOML Einführungbeispiele Beispiele aus einer annotated Datenbank Spezieller BIOML Browser und Editor Evtl. Friends von BIOML

3 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends3 Kurzbeschreibung: BIOML erlaubt alle experimentellen Informationen über eine molekulare Einheit bestehend aus Biopolymeren wie zum Beispiel Proteine und Gene zu spezifizieren und darzustellen. BIOML- Biopolymer Markup Language Working Draft Proposal (kein W3C Working Draft): (erste Version) von

4 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends4 BIOML - Was sind die Ziele? BIOML soll... ein erweiterbares Framework für die Darstellung von Biopolymeren wie zum Beispiel Proteine und Gene liefern. ein brauchbares Werkzeug für Biologen und andere Naturwissenschaftler liefern, um Informationen zu biopolymeren Sequenzen über das World Wide Web oder ein Intranet auszutauschen. die entsprechende Darstellung vereinheitlichen, also einen (firmeninternen) Standard liefern.

5 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends5 BIOML - Entwicklungskriterien BIOML Dokument soll eine zuverlässige Repräsentation des Gen-Protein-Konzepts sein. Alle bekannten experimentellen Daten über dieses Objekt sollen logisch, zu einem biologisch bedeutungsvollen und aussagekräftigen Gebilde zusammengefügt werden. Das Dokument soll für den Forscher übersichtlich sein. Information soll gebündelt und hierarchisch in eine Baum- Blatt-Struktur eingepasst werden. Dokument soll leicht erweiterbar, transferierbar und implementierbar sein. Es soll Konversionen von anderen Daten zu BIOML und vice versa unterstützen.

6 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends6 BIOML – Inhaltsverzeichnis Welche Typen von Informationen müssen mit der biopolymeren Sequenz im BIOML Dokument abgelegt sein, damit die Information nützlich (für die biologische Forschung) ist? Strukturinformation: Crosslinks Zusammensetzung Notizen zu Modifikationen und Aberrationen Assoziierte Information (Funktion, Pathologie usw.) Allgemeine Information (Autor, Datum etc.) Literaturreferenzen (u.a. Webadressen) Vergleich mit anderen Daten aus Datenbanken Key Attribute (für Datenbanken )

7 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends7 BIOML – Biologischer Kontext Proteine Vom Gen zum Protein Tags, Visualisierung im Browser, DTD

8 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends8 Proteine

9 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends9 Proteine Kontrolle der Stoffwechselvorgänge Zellmaschinerie Strukturelemente Linearer Aufbau mit Querverbindungen

10 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends10 Vom Gen zum Protein Transkription (Compile) Translation (Run)

11 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends11 Transkription 4 verschiedene Zeichen/Basen (ACTG) auf DNA Proteine aus 20 verschiedenen Aminosäuren aufgebaut agccctccaggacaggctgcatca Codons StopStart20 Aminosäuren Abfolge der Codons = Abfolge der Aminosäuren

12 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends12 Translation

13 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends13 Translation

14 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends14 Translation Aneinanderreihung der Aminosäuren 3D Struktur Proprotein - Protein Domänen, Strukturen

15 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends15 Tags

16 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends16 Erweiterbarkeit domain type (Protein) aa type (Aminosäure)

17 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends17 BIOML – Allgemeine Elemente (1) Elemente zum allgemeinen Zweck meistens Blätter in der Baumstruktur z.B.,,, usw. Organismus definierende Elemente umschliessen Tags der biopolymeren Sequenzen z.B,, usw. Ortsdefinierende Elemente z.B,, usw.

18 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends18 BIOML – Allgemeine Elemente (2) Literaturreferenzen Tag Blätter von :,,, usw. Sie haben nur eine Bedeutung, wenn sie von... umschlossen sind.... Arber W. restriction enzymes Nature 13...

19 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends19 BIOML – Allgemeine Elemente (3) Datenbankreferenzen Tag (immer leeres Element) Attribute: format, query, entry Beispiel: ...

20 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends20 BIOML – Allgemeine Elemente (4) URL-basierte Resourcen Element mit Attribute: format, query Element mit Attribute: format, query (CGI) Beide Elemente sind immer leer

21 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends21 BIOML – Globale Attribute & Entitäten Einige Attribute können in alle Elemente implementiert werden: label Bezeichner für ein bestimmtes Element (Browser braucht ihn als Platzhalter) state hide, open oder close. Information für Browser, wie das entsprechende Element dargestellt werden soll. id Identifikationsnummer für Katalogisierungszweck Entitäten - global zur Verfügung stehende Mnemonics: Å: &angstrom; usw.

22 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends22 Friends von BIOML MoDL SBML CellML StarDOM GeneXML MAGE-ML GAME BSML MSAML PROXIML GEML MAML ChemML

23 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends23 Friends von BIOML MoDL: Molecular Dynamics [Markup] Language SBML:Systems Biology Markup Language CellML:Cell Markup Language StarDOM: Transforming Scientific Data into XML GeneXML:GeneX Gene Expression Markup Language MAGE-ML:MicroArray and Gene Expression Markup Language GAME:Genome Annotation Markup Elements BSML:Bioinformatic Sequence Markup Language MSAML:XML for Multiple Sequence Alignments PROXIML:Protein Extensible Markup Language GEML:Gene Expression Markup Language MAML:Microarray Markup Language ChemML:Chemical Markup Language

24 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends24 BSML – Bioinformatic Sequence Markup Language ~ BIOML Standardisierung Graphische Darstellung von Sequenzen und spezielle Ausprägungen Zugriff auf fremde Ressourcen Durchmusterung von Genabschnitten mit Hilfe des BSML- Browsers

25 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends25 CellML – Cell Markup Language Speicherung und Austausch von computerbasierten biologischen Modellen. Unterstützung verschiedener Modell bildenden Programme Möglichkeit der Wiederverwendung von Komponenten eines Modells in anderen Modellen > Beschleunigung der Modellbildung Information zur Modellstruktur, wie die einzelnen Komponenten untereinander organisiert sind. Information zur Mathematik (Gleichungen für biologische Prozesse) > MathML implementiert Zusätzliche Daten für Suche von spezischen Modellen in Datenbanken

26 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends26 BIOML & Friends - Links BIOML Homepage WDP DTD BioBrowser v1.3 Übersicht XML in Bioinformatik Friends Übersicht von OASIS Praktisch jede Auszeichnungssprache hat ihre Homepage. Z.B.


Herunterladen ppt "BIOML & Friends George Gentsch, Lukas Stingelin. 5. Juni 2002 Seminar XML-Technologien/BIOML & Friends2 BIOML & Friends Übersicht Allgemeine Einführung."

Ähnliche Präsentationen


Google-Anzeigen