Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

12.06.2003Proseminar BioVis A. Brück & K. Scheiffele 1 / 81 Visualisierung von Sequenzvergleichen.

Ähnliche Präsentationen


Präsentation zum Thema: "12.06.2003Proseminar BioVis A. Brück & K. Scheiffele 1 / 81 Visualisierung von Sequenzvergleichen."—  Präsentation transkript:

1 Proseminar BioVis A. Brück & K. Scheiffele 1 / 81 Visualisierung von Sequenzvergleichen

2 Ein paar Worte vorweg

3 Proseminar BioVis A. Brück & K. Scheiffele 3 / 81 Wir stellen uns vor: André Brück Kai Scheiffele

4 Proseminar BioVis A. Brück & K. Scheiffele 4 / 81 Warum Visualisierung von Sequenzvergleichen?

5 Proseminar BioVis A. Brück & K. Scheiffele 5 / 81 Warum Visualisierung von Sequenzvergleichen? Datenmenge steigt immer weiter und immer schneller an

6 Proseminar BioVis A. Brück & K. Scheiffele 6 / 81 Warum Visualisierung von Sequenzvergleichen? Datenmenge steigt immer weiter und immer schneller an Visualisierung von Sequenzvergleichen erleichtert es dem Wissenschaftler enorm neue Daten auszuwerten und Ergebnisse einzuordnen

7 Gliederung

8 Proseminar BioVis A. Brück & K. Scheiffele 8 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung anschl. Fragen / Diskussion

9 Proseminar BioVis A. Brück & K. Scheiffele 9 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung anschl. Fragen / Diskussion

10 Proseminar BioVis A. Brück & K. Scheiffele 10 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung anschl. Fragen / Diskussion

11 Proseminar BioVis A. Brück & K. Scheiffele 11 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung anschl. Fragen / Diskussion

12 Proseminar BioVis A. Brück & K. Scheiffele 12 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung anschl. Fragen / Diskussion

13 Grundlagen

14 Proseminar BioVis A. Brück & K. Scheiffele 14 / 81 Grundlagen DNA

15 Proseminar BioVis A. Brück & K. Scheiffele 15 / 81 Grundlagen DNA DNA ist das Molekül mit der primären genetischen Information. Sie wird aus den vier Nucleotiden A, T, G und C zusammengesetzt

16 Proseminar BioVis A. Brück & K. Scheiffele 16 / 81 Grundlagen DNA DNA ist das Molekül mit der primären genetischen Information. Sie wird aus den vier Nucleotiden A, T, G und C zusammengesetzt Ein Codon ist ein Nucleotid-Triplet, welches für bestimmte Aminosäuren oder Termination codiert

17 Proseminar BioVis A. Brück & K. Scheiffele 17 / 81 Grundlagen DNA Der offene Leserahmen (ORF) besteht aus einer Reihe von Codons, die für ein Peptid codieren Auf doppelsträngiger DNA gibt es sechs solcher ORFs sgd3prob.html

18 Proseminar BioVis A. Brück & K. Scheiffele 18 / 81 Grundlagen Datenbanken

19 Proseminar BioVis A. Brück & K. Scheiffele 19 / 81 Grundlagen Datenbanken Datenbanken sind ein Hilfsmittel, welches die Informatik bereitstellt und dienen der Speicherung und Wiedergewinnung von umfangreichen Datenmengen

20 Proseminar BioVis A. Brück & K. Scheiffele 20 / 81 Grundlagen Datenbanken Datenbanken sind ein Hilfsmittel, welches die Informatik bereitstellt und dienen der Speicherung und Wiedergewinnung von umfangreichen Datenmengen Datenbanken mit genetischen Sequenzen eignen sich besonders für Sequenzvergleiche (siehe BLAST, FASTA)

21 Proseminar BioVis A. Brück & K. Scheiffele 21 / 81 Grundlagen Sequenzierung

22 Proseminar BioVis A. Brück & K. Scheiffele 22 / 81 Grundlagen Sequenzierung Die Sequenzierung (z.B. über PCR) liefert Rohdaten für die Datenbank

23 Proseminar BioVis A. Brück & K. Scheiffele 23 / 81 Grundlagen Sequenzierung Die Sequenzierung (z.B. über PCR) liefert Rohdaten für die Datenbank Format: ASN.1, FASTA,…

24 Proseminar BioVis A. Brück & K. Scheiffele 24 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

25 Algorithmen

26 Proseminar BioVis A. Brück & K. Scheiffele 26 / 81 Algorithmen BLAST –Wissenswertes –Mathematische Grundlagen –Wirkungsweise –Vorteile / Nachteile FASTA –Wissenswertes –Vorteile / Nachteile

27 Proseminar BioVis A. Brück & K. Scheiffele 27 / 81 BLAST Wissenswertes Basic Local Alignment Search Tools Beschrieben von Stephen F. Altschul et al. (1990) Effizienter Algorithmus zum Finden von Gleichheiten / Verwandtschaften zwischen DNA / Proteinsequenzen Findet die ähnlichste(n) Sequenz(en) innerhalb einer BLAST-Datenbank Als Web-Tool oder Stand- Alone (PC, UNIX, Mac)

28 Proseminar BioVis A. Brück & K. Scheiffele 28 / 81 BLAST Wissenswertes (2) BLASTP – Protein / Protein-Vergleich BLASTN – DNA / DNA-Vergleich BLASTX – DNA / Protein-Vergleich (2x3RF) TBLASTN – Protein / DNA-Vergleich (2x3RF) TBLASTX – Protein in DNA / Protein in DNA DB (6*6 Reading Frames) BLAST2 – advanced BLAST / inkl. GAPs PSIBLAST – Position Specific Iterated Protein / Protein (mehrere Durchgänge)

29 Proseminar BioVis A. Brück & K. Scheiffele 29 / 81 BLAST Mathematische Grundlagen BLAST geht von 2 Sequenzen A(subject) und B(query) aus mit A = a 1 a 2....a n und B = b 1 b 2...b n. Einfacher Vergleich (z.B. a 1 -b 1 ) aufgrund Deletion, Insertion, ReadingFrames nicht möglich. Aufbau einer Matrix mit verschiedenen Gewichtungen für alle möglichen, vorkommenden Paare von Sequenzteilen.

30 Proseminar BioVis A. Brück & K. Scheiffele 30 / 81 BLAST Wirkungsweise Matrix: Alle RFs werden parallel durchsucht (mittels Pointer) nur ein Durchlauf für alle RF´s BLAST2 kann auch GAPs ermitteln Beispiele für Gewichtungen: –Match 5 –Mismatch –4 Verschiedene Matrizen: –BLOSUM62 –PAM120

31 Proseminar BioVis A. Brück & K. Scheiffele 31 / 81 BLAST Vorteile / Nachteile Vorteile –Schnell / Effizient –Variabel –Kostenlos Nachteile –Ausgabe muss weiter überarbeitet werden –Ausgabe wächst mit der Größe der Datenbank (Verdopplung DB alle 1.2 Jahre, PubMed)

32 Proseminar BioVis A. Brück & K. Scheiffele 32 / 81 Algorithmen BLAST –Wissenswertes –Mathematische Grundlagen –Wirkungsweise –Vorteile / Nachteile FASTA –Wissenswertes –Vorteile / Nachteile

33 Proseminar BioVis A. Brück & K. Scheiffele 33 / 81 FASTA Wissenswertes Auch hier verschiedene Typen: -FastA: DNA/DNA -FastX: DNA/Protein (GAPs nur zw. Codons) -FastY: DNA/Protein (inkl. GAPs) - TFastA: Protein/DNA

34 Proseminar BioVis A. Brück & K. Scheiffele 34 / 81 FASTA Vorteile / Nachteile Vorteile –Findet GAPs selbst innerhalb von Codons –Sensitiver als BLAST Nachteile –Findet nur 1 passendes Segment –Langsamer als BLAST

35 Proseminar BioVis A. Brück & K. Scheiffele 35 / 81 FASTA Format Beispiel 1: AY SARS coronavirus...[gi: ] AGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTATCGTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTT CGTCCGTGTTGCAGTCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTCTTGGTGTCAACGAGAAAACACACGTCCAA CTCAGTTTGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCGTGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAACACCTCAAAAATGGCACTTGT GGTCTAGTAGAGCTGGAAAAAGGCGTACTGCCCCAGCTTGAACAGCCCTATGTGTTCATTAAACGTTCTGATGCCTTAAGCACCAATCACGGCCACAAGGTCGTTGAG CTGGTTGCAGAAATGGACGGCATTCAGTACGGTCGTAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGCGAAACCCCAATTGCATACCGCAATGTTCTTCTT CGTAAGAACGGTAATAAGGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAGGTGACGAGCTTGGCACTGATCCCATTGAAGATTATGAACAAA ACTGGAACACTAAGCATGGCAGTGGTGCACTCCGTGAACTCACTCGTGAGCTCAATGGAGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGCCCAGATGGGT ACCCTCTTGATTGCATCAAAGATTTTCTCGCACGCGCGGGCAAGTCAATGTGCACTCTTTCCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTCTACTGCTGCCG TGACCATGAGCATGAAATTGCCTGGTTCACTGAGCGCTCTGATAAGAGCTACGAGCACCAGACACCCTTCGAAATTAAGAGTGCCAAGAAATTTGACACTTTCAAAGGG GAATGCCCAAAGTTTGTGTTTCCTCTTAACTCAAAAGTCAAAGTCATTCAACCACGTGTTGAAAAGAAAAAGACTGAGGGTTTCATGGGGCGTATACGCTCTGTGTACCC TTTTGCATCTCCACAGGAGTGTAACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGTTTCATGGCAGACGTGCGACTTTCTGAAAGCCACTTGTG AACATTGTGGCACTGAAAATTTAGTTATTGAAGGACCTACTACATGTGGGTACCTACCTACTAATGCTGTAGTGAAAATGCCATGTCCTGCCTGTCAAGACCCAGAGATT GGACCTGAGCATAGTGTTGCAGATTATCACAACCACTCAAACATTGAAACTCGACTCCGCAAGGGAGGTAGGACTAGATGTTTTGGAGGCTGTGTGTTTGCCTATGTTG GCTGCTATAATAAGCGTGCCTACTGGGTTCCTCGTGCTAGTGCTGATATTGGCTCAGGCCATACTGGCATTACTGGTGACAATGTGGAGACCTTGAATGAGGATCTCCT TGAGATACTGAGTCGTGAACGTGTTAACATTAACATTGTTGGCGATTTTCATTTGAATGAAGAGGTTGCCATCATTTTGGCATCTTTCTCTGCTTCTACAAGTGCCTTTAT TGACACTATAAAGAGTCTTGATTACAAGTCTTTCAAAACCATTGTTGAGTCCTGCGGTAACTATAAAGTTACCAAGGGAAAGCCCGTAAAAGGTGCTTGGAACATTGGAC AACAGAGATCAGTTTTAACACCACTGTGTGGTTTTCCCTCACAGGCTGCTGGTGTTATCAGATCAATTTTTGCGCGCACACTTGATGCAGCAAACCACTCAATTCCTGAT TTGCAAAGAGCAGCTGTCACCATACTTGATGGTATTTCTGAACAGTCATTACGTCTTGTCGACGCCATGGTTTATACTTCAGACCTGCTCACCAACAGTGTCATTATTAT GGCATATGTAACTGGTGGTCTTGTACAACAGACTTCTCAGTGGTTGTCTAATCTTTTGGGCACTACTGTTGAAAAACTCAGGCCTATCTTTGAATGGATTGAGGCGAAAC TTAGTGCAGGAGTTGAATTTCTCAAGGATGCTTGGGAGATTCTCAAATTTCTCATTACAGGTGTTTTTGACATCGTCAAGGGTCAAATACAGGTTGCTTCAGATAACATC AAGGATTGTGTAAAATGCTTCATTGATGTTGTTAACAAGGCACTCGAAATGTGCATTGATCAAGTCACTATCGCTGGCGCAAAGTTGCGATCACTCAACTTAGGTGAAGT CTTCATCGCTCAAAGCAAGGGACTTTACCGTCAGTGTATACGTGGCAAGGAGCAGCTGCAACTACTCATGCCTCTTAAGGCACCAAAAGAAGTAACCTTTCTTGAAGGT GATTCACATGACACAGTACTTACCTCTGAGGAGGTTGTTCTCAAGAACGGTGAACTCGAAGCACTCGAGACGCCCGTTGATAGCTTCACAAATGGAGCTATCGTTGGCA CACCAGTCTGTGTAAATGGCCTCATGCTCTTAGAGATTAAGGACAAAGAACAATACTGCGCATTGTCTCCTGGTTTACTGGCTACAAACAATGTCTTTCGCTTAAAAGGG GGTGCACCAATTAAAGGTGTAACCTTTGGAGAAGATACTGTTTGGGAAGTTCAAGGTTACAAGAATGTGAGAATCACATTTGAGCTTGATGAACGTGTTGACAAAGTGC TTAATGAAAAGTGCTCTGTCTACACTGTTGAATCCGGTACCGAAGTTACTGAGTTTGCATGTGTTGTAGCAGAGGCTGTTGTGAAGACTTTACAACCAGTTTCTGATCTC CTTACCAACATGGGTATTGATCTTGATGAGTGGAGTGTAGCTACATTCTACTTATTTGATGATGCTGGTGAAGAAAACTTTTCATCACGTATGTATTGTTCCTTTTACCCT CCAGATGAGGAAGAAGAGGACGATGCAGAGTGTGAGGAAGAAGAAATTGATGAAACCTGTGAACATGAGTACGGTACAGAGGATGATTATCAAGGTCTCCCTCTGGAA TTTGGTGCCTCAGCTGAAACAGTTCGAGTTGAGGAAGAAGAAGAGGAAGACTGGCTGGATGATACTACTGAGCAATCAGAGATTGAGCCAGAACCAGAACCTACACCT GAAGAACCAGTTAATCAGTTTACTGGTTATTTAAAACTTACTGACAATGTTGCCATTAAATGTGTTGACATCGTTAAGGAGGCACAAAGTGCTAATCCTATGGTGATTGTA AATGCTGCTAACATACACCTGAAACATGGTGGTGGTGTAGCAGGTGCACTCAACAAGGCAACCAATGGTGCCATGCAAAAGGAGAGTGATGATTACATTAAGCTAAATG GCCCTCTTACAGTAGGAGGGTCTTGTTTGCTTTCTGACATAATCTTGCTAAGAAGTGTCTGCATGTTGTTGGACCTAACCTAAATGCAGGTGAGGACATCCAGCTCTTAA GGCAGCATATGAAAATTTCAATTCACAGGACATCTTACTTGCACCATTGTTGTCAGCAGGCATATTTGGTGCTAAACCACTTCAGTCTTTACAAGTGTGCGTGCAGACGG TTCGTACACAGGTTTATATTGCATCAATGACAAAGCTCTTTATGAGCAGGTTGTCATGGATTATCTTGATAACCTGAAGCCTAGAGTGGAA

36 Proseminar BioVis A. Brück & K. Scheiffele 36 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

37 Visualisierungstools

38 Proseminar BioVis A. Brück & K. Scheiffele 38 / 81 SimiTri Übersicht Methoden Visualisierung Vorteile / Nachteile Zusammenfassung

39 Proseminar BioVis A. Brück & K. Scheiffele 39 / 81 SimiTri Übersicht JAVA / Perl – based Applet Zum Vergleich von 3 Datensätzen Schnelle Übersicht von Verwandtschaften Vereinfacht z.B. Evolutionsforschung

40 Proseminar BioVis A. Brück & K. Scheiffele 40 / 81 SimiTri Übersicht (2) Selekt. Cluster (Name) Mapper Datensätze Visualisierung Cutoff-Score Zoom-Balken

41 Proseminar BioVis A. Brück & K. Scheiffele 41 / 81 SimiTri Methoden Erstellen von einem similarity profile –Mittels BLAST-Suche gegen versch. DB –50 high score-Cluster (Ähnliche Sequenzen werden zu Clustern zusammen- gefasst) –Alle Scores gegenseitig in Relation setzen. –Sequenzliste wird unterhalb der Grafik mit ausgegeben.

42 Proseminar BioVis A. Brück & K. Scheiffele 42 / 81 SimiTri Visualisierung BLAST-Score = relative Entfernung des Clusters vom Zentrum Farbe = Cutoff- Score Räumliche Anordnung im Dreieck = Näher verwandt mit...

43 Proseminar BioVis A. Brück & K. Scheiffele 43 / 81 SimiTri Visualisierung (2) Protein aus A näher verwandt mit B als mit CProtein aus A näher verwandt mit B als mit C In allen DB gleichIn allen DB gleich Protein in B und C gleich, nicht in A.Protein in B und C gleich, nicht in A. A BC

44 Proseminar BioVis A. Brück & K. Scheiffele 44 / 81 SimiTri Vorteile / Nachteile Vorteile: –Übersichtlich –Viele Information bei Selektion eines Cluster Nachteile –Nur 3 Organismen –Nur 50 Cluster –Z.Zt. nur online für Nematoden

45 Proseminar BioVis A. Brück & K. Scheiffele 45 / 81 SimiTri Zusammenfassung Farbige, graphische Auswertung Interaktiv Zoombar Übersichtlich Schnell Kostenlos

46 Alignment Viewer (AV)

47 Proseminar BioVis A. Brück & K. Scheiffele 47 / 81 Alignment Viewer Übersicht Wofür ist der AV gut? Wie arbeitet der AV? Was bietet der AV noch für Möglichkeiten? Was kann der Wissenschaftler mit dem AV erkennen? Wie sieht die Zukunft des AV aus?

48 Proseminar BioVis A. Brück & K. Scheiffele 48 / 81 AV Wofür ist der AV gut?

49 Proseminar BioVis A. Brück & K. Scheiffele 49 / 81 AV Wofür ist der AV gut? Algorithmen wie BLAST liefern nur eine Textausgabe:

50 Proseminar BioVis A. Brück & K. Scheiffele 50 / 81

51 Proseminar BioVis A. Brück & K. Scheiffele 51 / 81 AV Wofür ist der AV gut? Algorithmen wie BLAST liefern nur eine Textausgabe:

52 Proseminar BioVis A. Brück & K. Scheiffele 52 / 81 AV Wofür ist der AV gut? Algorithmen wie BLAST liefern nur eine Textausgabe: AV hilft bei der Analyse von Sequenzvergleichen durch Visualisierungs- techniken:

53 Proseminar BioVis A. Brück & K. Scheiffele 53 / 81 AV Wie arbeitet der AV?

54 Proseminar BioVis A. Brück & K. Scheiffele 54 / 81 AV Wie arbeitet der AV?

55 Proseminar BioVis A. Brück & K. Scheiffele 55 / 81 AV Wie arbeitet der AV?

56 Proseminar BioVis A. Brück & K. Scheiffele 56 / 81 AV Wie arbeitet der AV? X-Achse: Eingabesequenz

57 Proseminar BioVis A. Brück & K. Scheiffele 57 / 81 AV Wie arbeitet der AV? X-Achse: Eingabesequenz Y-Achse: Similarity score

58 Proseminar BioVis A. Brück & K. Scheiffele 58 / 81 AV Wie arbeitet der AV? X-Achse: Eingabesequenz Y-Achse: Similarity score Z-Achse: Leserahmen (auch durch Farben möglich)

59 Proseminar BioVis A. Brück & K. Scheiffele 59 / 81 AV Was bietet der AV noch für Möglichkeiten?

60 Proseminar BioVis A. Brück & K. Scheiffele 60 / 81 AV Was bietet der AV noch für Möglichkeiten? Hyperlinks (detail-on-demand)

61 Proseminar BioVis A. Brück & K. Scheiffele 61 / 81 AV Was bietet der AV noch für Möglichkeiten? Hyperlinks (detail-on-demand) Unabhängige Skalierung aller Achsen

62 Proseminar BioVis A. Brück & K. Scheiffele 62 / 81 AV Was bietet der AV noch für Möglichkeiten? Hyperlinks (detail-on-demand) Unabhängige Skalierung aller Achsen Animierung durch 4. Dimension (Zeit)

63 Proseminar BioVis A. Brück & K. Scheiffele 63 / 81 AV Was bietet der AV noch für Möglichkeiten? Hyperlinks (detail-on-demand) Unabhängige Skalierung aller Achsen Animierung durch 4. Dimension (Zeit) Freie Belegung der 4 Dimensionen (X, Y, Z, Zeit) mit den 12 Variablen eines Alignments

64 Proseminar BioVis A. Brück & K. Scheiffele 64 / 81 AV Was bietet der AV noch für Möglichkeiten? Hyperlinks (detail-on-demand) Unabhängige Skalierung aller Achsen Animierung durch 4. Dimension (Zeit) Freie Belegung der 4 Dimensionen (X, Y, Z, Zeit) mit den 12 Variablen eines Alignments Filterung

65 Proseminar BioVis A. Brück & K. Scheiffele 65 / 81 AV Was kann der Wissenschaftler mit dem AV erkennen?

66 Proseminar BioVis A. Brück & K. Scheiffele 66 / 81 AV Was kann der Wissenschaftler mit dem AV erkennen? Das Verhältnis zwischen Eingabesequenz und Alignments

67 Proseminar BioVis A. Brück & K. Scheiffele 67 / 81 AV Was kann der Wissenschaftler mit dem AV erkennen? Das Verhältnis zwischen Eingabesequenz und Alignments Den korrekten Leserahmen

68 Proseminar BioVis A. Brück & K. Scheiffele 68 / 81 AV Was kann der Wissenschaftler mit dem AV erkennen? Das Verhältnis zwischen Eingabesequenz und Alignments Den korrekten Leserahmen Eventuelle Frame Shifts

69 Proseminar BioVis A. Brück & K. Scheiffele 69 / 81 AV Was kann der Wissenschaftler mit dem AV erkennen? Das Verhältnis zwischen Eingabesequenz und Alignments Den korrekten Leserahmen Eventuelle Frame Shifts Konservierte Regionen

70 Proseminar BioVis A. Brück & K. Scheiffele 70 / 81 AV Wie sieht die Zukunft des AV aus?

71 Proseminar BioVis A. Brück & K. Scheiffele 71 / 81 AV Wie sieht die Zukunft des AV aus? Flexiblere Filter

72 Proseminar BioVis A. Brück & K. Scheiffele 72 / 81 AV Wie sieht die Zukunft des AV aus? Flexiblere Filter Simultane Visualisierung von mehreren Suchreporten

73 Proseminar BioVis A. Brück & K. Scheiffele 73 / 81 AV Wie sieht die Zukunft des AV aus? Flexiblere Filter Simultane Visualisierung von mehreren Suchreporten Mehr Plattformen (bisher nur SGI und Sun)

74 Proseminar BioVis A. Brück & K. Scheiffele 74 / 81 Gliederung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

75

76 Proseminar BioVis A. Brück & K. Scheiffele 76 / 81 Zusammenfassung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

77 Proseminar BioVis A. Brück & K. Scheiffele 77 / 81 Zusammenfassung Einführung Wofür Visualisierung von Sequenzvergl? Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

78 Proseminar BioVis A. Brück & K. Scheiffele 78 / 81 Zusammenfassung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools Zwei Beispiele solcher Tools –SimiTri –Alignment Viewer Zusammenfassung

79 Proseminar BioVis A. Brück & K. Scheiffele 79 / 81 Zusammenfassung Einführung Grundlagen –DNA –Datenbanken –Sequenzierung Algorithmen Algorithmen auf denen die Tools basieren –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

80 Proseminar BioVis A. Brück & K. Scheiffele 80 / 81 Zusammenfassung Einführung Grundlagen Grundlegende Begriffe zum Verständnis der Algos –DNA –Datenbanken –Sequenzierung Algorithmen –BLAST –FASTA Visualisierungs - Tools –SimiTri –Alignment Viewer Zusammenfassung

81 Danke für Eure Aufmerksamkeit!


Herunterladen ppt "12.06.2003Proseminar BioVis A. Brück & K. Scheiffele 1 / 81 Visualisierung von Sequenzvergleichen."

Ähnliche Präsentationen


Google-Anzeigen