Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen Titel Bitte hier Namen im Master angeben Eröffnungskolloquium „Environmental.

Ähnliche Präsentationen


Präsentation zum Thema: "GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen Titel Bitte hier Namen im Master angeben Eröffnungskolloquium „Environmental."—  Präsentation transkript:

1 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen Titel Bitte hier Namen im Master angeben Eröffnungskolloquium „Environmental Informatics“ Bioinformatik Burkhard Morgenstern Institut für Mikrobiologie und Genetik Abteilung für Bioinformatik Göttingen, Januar 2006

2 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Definition: Bioinformatics = Development and application of Computer Science in Molecular Biosciences

3 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics in Göttingen Chair of Bioinformatics, Faculty of Medicine (E. Wingender) Chair of Bioinformatics, Faculty of Biology (B.M.) Theoretical Computer Science, Institute of Informatics (S. Waack) Göttinger Laboratorium für Genomanalyse G 2 L (G. Gottschalk)

4 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern

5 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics at Institute of Microbiology and Genetics (since 12/02) Research focus: Algorithm and software development for nucleic acid and protein sequence analysis Bioinformatics support for Life Scientists

6 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Development of software tools: Gene discovery Comparative sequence analysis Machine learning Phylogeny reconstruction

7 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Gene predictions for eukaryotes attgccagtacgtagctagctacacgtatgctattacggat ctgtagcttagcgtatctgtatgctgttagctgtacgtacg tatttttctagagcttcgtagtctatggctagtcgtagtcg tagtcgttagcatctgtatgctgttagctgtacgtacgtat ttttctagagcttcgtagtctatggctagtcgtagtcgtag tcgttagcatctgtatgctgttagctgtacgtacgtatttt tctaggggagcttcgtagtctatggctagtcgtagtcgtag tcgttagcatctgtatgctgttagctgtacgtacgtatttt tctaggggagcttcgtagtctatggctagtcgtagtcgtag tcgttagcatctgtatgctgttagctgtacgtacgtatttt tctaggggagcttcgtagtctatggctagtcgtagtcgtag tcgttagcttagtcgtgtagtcttgatc

8 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Gene predictions for eukaryotes attgccagtacgtagctagctacacgtatgctattacggat ctgtagcttagcgtatctgtatgctgttagctgtacgtacg tatttttctagagcttcgtagtctatggctagtcgtagtcg tagtcgttagcatctgtatgctgttagctgtacgtacgtat ttttctagagcttcgtagtctatggctagtcgtagtcgtag tcgttagcatctgtatgctgttagctgtacgtacgtatttt tctaggggagcttcgtagtctatggctagtcgtagtcgtag tcgttagcatctgtatgctgttagctgtacgtacgtatttt tctaggggagcttcgtagtctatggctagtcgtagtcgtag tcgttagcatctgtatgctgttagctgtacgtacgtatttt tctaggggagcttcgtagtctatggctagtcgtagtcgtag tcgttagcttagtcgtgtagtcttgatc

9 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B.Morgenstern Gene predictions for eukaryotes

10 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Gene predictions for eukaryotes Three different approaches: Intrinsic: use statistical information about known genes (Hidden Markov Models) Extrinsic: compare genomic sequence with known proteins / genes Cross-species sequence comparison: search for similarities among genomes

11 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B.Morgenstern Gene predictions for eukaryotes Comparison of genomic sequences (human and mouse)

12 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B.Morgenstern Gene predictions for eukaryotes

13 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Gene predictions for eukaryotes AUGUSTUS (M. Stanke) Gene finding using heterogeneous sources of information

14 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B.Morgenstern Gene predictions for eukaryotes

15 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Algorithms for Sequence Alignment s1 W T Y I V M R E A Q Y E S A Q s2 R C L V M R E A Q E W s3 Y I M Q E V Q Q E R A s4 A L Y I A M R E V Q Y E S A

16 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Algorithms for Sequence Alignment s1 W T Y I V M R E A Q Y E S A Q s2 - R C L V M R E A Q - E W - - s3 - - Y I - M Q E V Q Q E R A - s4 A L Y I A M R E V Q Y E S A -

17 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Algorithms for Sequence Alignment s1 W T Y I V M R E A Q Y E S A Q s2 - R C L V M R E A Q - E W - - s3 - - Y I - M Q E V Q Q E R A - s4 A L Y I A M R E V Q Y E S A - Conserved motifs functionally important! Alignment basis for phylogeny reconstruction

18 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Algorithms for Sequence Alignment Detection of regulatory sites for the SCL gene (B. Göttgens et al., 2002)

19 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics projects related to PEI

20 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B.Morgenstern ZfI Umweltinformatik (Promotionsprogramm im Rahmen von GAUSS) Fokus Biodiversität Leuschner, Schütz, Tscharntke Ökosysteme Leuschner, Beese, Schütz, N.N. Global Change Gravenhorst, Beese, Gerold, Veldkamp Landnutzungssysteme Waldbau, Pflanzenbau, Produktion Bioinformatik Skalentransfermodelle Modelle der Morphogenese von Organen Gendatenbanken Regulatorische Netzwerke Modelle der Genexpression Sequenzanalyse Phylogenetische Bäume u.ä. Ökoinformatik Skalentransfermodelle Struktur und Funktionsmodelle für Biota Erweiterte Lindenmayersysteme Neuronale Netze Artificial Life Biodiversitätsmodelle Ökosystemmodelle Raumbezogene Umweltinformationssysteme Visualisierung Biometrische Modelle u.ä. Geoinformatik Skalentransfermodelle GIS Remote Sensing Modelle für Landnutzungsysteme Landschaftsmodelle Computergestüzte Kartographie Modelle für Wassereinzugsgebiete Raumbezogene Netzwerke Globale Klimamodelle u.ä. Sprecher Sloboda / N.N.Sprecher Kappas Sprecher Morgenstern Datenintegration, Austausch und Scientific Workflows May Wiss. Rechnen, Prozessmodellierung Schaback Graph. Datenverarbeitung, Artificial Life N.N. Algorithmentechniken Waack Sensorik und Telematik der Messprozesse Hogrefe Polle, Leuschner, Becker, Finkeldey, Schütz, Schäfer, Tscharntke Klimasysteme, Prozesse, Energiebilanzmodelle Gravenhorst, Ibrom Biota, Populationen, Biodiversität, genet. Ressourcen, ökophysiologische Prozesse Bodensysteme, Prozesse, räumliche Grundwasser- und Stofftransportmodelle, Interaktion Boden-Biota-Klima Beese, Flessa ZfI Umweltinformatik (Promotionsprogramm im Rahmen von GAUSS) Fokus Biodiversität Leuschner, Schütz, Tscharntke Ökosysteme Leuschner, Beese, Schütz, N.N. Global Change Gravenhorst, Beese, Gerold, Veldkamp Landnutzungssysteme Waldbau, Pflanzenbau, Produktion Bioinformatik Skalentransfermodelle Modelle der Morphogenese von Organen Gendatenbanken Regulatorische Netzwerke Modelle der Genexpression Sequenzanalyse Phylogenetische Bäume u.ä. Ökoinformatik Skalentransfermodelle Struktur und Funktionsmodelle für Biota Erweiterte Lindenmayersysteme Neuronale Netze Artificial Life Biodiversitätsmodelle Ökosystemmodelle Raumbezogene Umweltinformationssysteme Visualisierung Biometrische Modelle u.ä. Geoinformatik Skalentransfermodelle GIS Remote Sensing Modelle für Landnutzungsysteme Landschaftsmodelle Computergestüzte Kartographie Modelle für Wassereinzugsgebiete Raumbezogene Netzwerke Globale Klimamodelle u.ä. Sprecher Sloboda / N.N.Sprecher Kappas Sprecher Morgenstern Datenintegration, Austausch und Scientific Workflows May Wiss. Rechnen, Prozessmodellierung Schaback Graph. Datenverarbeitung, Artificial Life N.N. Algorithmentechniken Waack Sensorik und Telematik der Messprozesse Hogrefe Polle, Leuschner, Becker, Finkeldey, Schütz, Schäfer, Tscharntke Klimasysteme, Prozesse, Energiebilanzmodelle Gravenhorst, Ibrom Biota, Populationen, Biodiversität, genet. Ressourcen, ökophysiologische Prozesse Bodensysteme, Prozesse, räumliche Grundwasser- und Stofftransportmodelle, Interaktion Boden-Biota-Klima Beese, Flessa

21 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics projects related to PEI Ecology (Forstbotanik: A. Polle, U. Kües): Coprinus Cinereus (genome sequence available) Pleurotus Ostreatus (genome proposal submitted)

22 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics projects related to PEI Coprinus Cinereus genome project: Gene prediction using AUGUSTUS (Stanke et al.) Identification of proteine families

23 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B.Morgenstern Bioinformatics projects related to PEI Coprinus Cinereus

24 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics projects related to PEI Pleurotus Ostreatus

25 GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen B. Morgenstern Bioinformatics projects related to PEI Developmental Biology (Zoology: E. Wimmer) Tribolium castaneum genome project Phylogeny reconstruction (Geobiology: J. Reitner, G. Wörheide) Phylogeny of sponges (DFG project WO 896/6-1)


Herunterladen ppt "GAUSS – Promotionsprogramm für Umweltinformatik Georg-August-Universität Göttingen Titel Bitte hier Namen im Master angeben Eröffnungskolloquium „Environmental."

Ähnliche Präsentationen


Google-Anzeigen