Die Präsentation wird geladen. Bitte warten

Die Präsentation wird geladen. Bitte warten

Paarweises Sequenz-Alignment Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben. Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA Seq2.

Ähnliche Präsentationen

Präsentation zum Thema: "Paarweises Sequenz-Alignment Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben. Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA Seq2."—  Präsentation transkript:

1 Paarweises Sequenz-Alignment Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben. Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA Seq2 GGGACATGGCAGTGACTGACCATGA

2 Paarweises Sequenz-Alignment Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben. Seq1 CTAATTAATG-CACAGTTAGGAATTAGAAATGA Seq2 GGGAC ATGGCA--GTGACTGACCATGA Aligne Paar von Segmenten der Sequenzen; ignoriere den Rest.

3 Paarweises Sequenz-Alignment Ziel beim lokalen Alignment: Finde Paar von Segmenten, so dass Alignment der Segmente maximalen Score hat. Wichtigste Anwendung: Datenbank suche: Finde Sequenzen in der Datenbank, die zu gegebener Sequenz (Anfrage-Sequenz, query sequence) ähnlich sind.

4 Paarweises Sequenz-Alignment Exaktes lokales Alignment zu zeitaufwendig. Schnelles Datenbank-Suchprogramm: BLAST - Basic Local Alignment Search Tool Stephen Altschul et al, JMB, 1990 21.778 Zitate in der Literatur ! Wichtigstes Werkzeug in der Bioinformatik!

5 Paarweises Sequenz-Alignment

6 NCBI – National Center of Biotechnological Information

7 Paarweises Sequenz-Alignment BLAST - Basic Local Alignment Search Tool Idee: Finde lokale Alignments ohne Gaps (HSPs – high scoring segment pairs). 1. Suche kurze Wort-Paare (feste Länge) 2. Dehne Wort-Paare aus, bis Score abfällt 3. Berechne Wahrscheinlichkeit, HSP per Zufall zu finden: e-value, p-value






13 Paarweises Sequenz-Alignment Ausdehnung gefundener Wort-Paare: Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA Seq2 GGGACATGGCAGTGACTGAATACACACCATGA TTAATGCACA TGAATACACA High-scoring segment pair (HSP)

14 Paarweises Sequenz-Alignment



17 Verbesserung: PSI-BLAST – Position Specific Iterative BLAST: (18.708 Zitate in der Literatur!)

18 Paarweises Sequenz-Alignment PSI-BLAST – Position Specific Iterative BLAST: 1. normale DB-Suche mit BLAST 2. Bilde Positions-Gewichts-Matrix (PWM) aus Treffern 3. Suche mit PWM nach neuen Treffern 4. Bilde verbesserte PWM … u.s.w.

19 Paarweises Sequenz-Alignment

Herunterladen ppt "Paarweises Sequenz-Alignment Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben. Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA Seq2."

Ähnliche Präsentationen
